Incidental Mutation 'R9470:Dnajc13'
ID 715429
Institutional Source Beutler Lab
Gene Symbol Dnajc13
Ensembl Gene ENSMUSG00000032560
Gene Name DnaJ heat shock protein family (Hsp40) member C13
Synonyms LOC382100, D030002L11Rik, Rme8
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock # R9470 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 104151282-104262930 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 104230720 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 254 (V254A)
Ref Sequence ENSEMBL: ENSMUSP00000139804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035170] [ENSMUST00000186788]
AlphaFold D4AFX7
Predicted Effect probably benign
Transcript: ENSMUST00000035170
AA Change: V254A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000035170
Gene: ENSMUSG00000032560
AA Change: V254A

DomainStartEndE-ValueType
low complexity region 706 719 N/A INTRINSIC
low complexity region 832 843 N/A INTRINSIC
low complexity region 913 926 N/A INTRINSIC
Blast:ARM 927 963 6e-12 BLAST
Pfam:DUF4339 976 1020 1.5e-18 PFAM
Blast:ARM 1071 1110 5e-12 BLAST
DnaJ 1300 1358 5.69e-18 SMART
low complexity region 1417 1426 N/A INTRINSIC
low complexity region 1813 1829 N/A INTRINSIC
Blast:ARM 1843 1884 6e-8 BLAST
low complexity region 1968 1984 N/A INTRINSIC
low complexity region 2006 2016 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186788
AA Change: V254A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000139804
Gene: ENSMUSG00000032560
AA Change: V254A

DomainStartEndE-ValueType
low complexity region 706 719 N/A INTRINSIC
low complexity region 837 848 N/A INTRINSIC
low complexity region 918 931 N/A INTRINSIC
Blast:ARM 932 968 6e-12 BLAST
Pfam:DUF4339 980 1025 8.1e-14 PFAM
Blast:ARM 1076 1115 5e-12 BLAST
DnaJ 1305 1363 5.69e-18 SMART
low complexity region 1422 1431 N/A INTRINSIC
low complexity region 1818 1834 N/A INTRINSIC
Blast:ARM 1848 1889 6e-8 BLAST
low complexity region 1973 1989 N/A INTRINSIC
low complexity region 2011 2021 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Dnaj protein family whose members act as co-chaperones of a partner heat-shock protein by binding to the latter and stimulating ATP hydrolysis. The encoded protein associates with the heat-shock protein Hsc70 and plays a role in clathrin-mediated endocytosis. It may also be involved in post-endocytic transport mechanisms via its associations with other proteins, including the sorting nexin SNX1. Mutations in this gene are associated with Parkinson's disease. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,165,493 H190R possibly damaging Het
4930467E23Rik T A 8: 19,747,793 S292T probably benign Het
5830411N06Rik A G 7: 140,247,432 T18A probably benign Het
Adgrb2 T A 4: 130,009,281 L558Q probably damaging Het
Apob A G 12: 7,989,219 D483G possibly damaging Het
Arid1a T C 4: 133,685,746 D994G unknown Het
Barx2 A T 9: 31,858,748 Y161* probably null Het
Bmp7 G T 2: 172,870,167 N421K probably damaging Het
Bod1l A T 5: 41,817,096 C2292S probably damaging Het
Ces1c C T 8: 93,104,118 probably null Het
Clca3b T C 3: 144,837,695 T458A probably damaging Het
Cntnap5a T G 1: 116,446,614 V952G probably damaging Het
Cyp2c54 T C 19: 40,072,444 E85G probably damaging Het
Dmxl1 A G 18: 49,893,710 K1962E possibly damaging Het
Dysf A T 6: 84,113,370 I955F possibly damaging Het
Fam184b A G 5: 45,584,512 S126P probably damaging Het
Gapvd1 A T 2: 34,712,268 D622E possibly damaging Het
Ggta1 T C 2: 35,402,755 Y180C probably damaging Het
Gpr31b A G 17: 13,051,958 V108A probably damaging Het
Kcnu1 A G 8: 25,919,632 Y861C probably benign Het
Mov10l1 T C 15: 89,020,315 L799P probably damaging Het
Nkx1-1 G A 5: 33,433,931 P16S unknown Het
Nos1 T C 5: 117,926,495 L997P probably damaging Het
Noxred1 A G 12: 87,223,055 Y301H possibly damaging Het
Olfr1467 A G 19: 13,364,751 N41S probably damaging Het
Olfr592 G A 7: 103,187,063 R154H probably benign Het
Olfr711 A T 7: 106,972,254 I30N probably benign Het
Olfr738 T C 14: 50,413,778 V78A possibly damaging Het
Olfr987 A T 2: 85,331,329 S190T probably damaging Het
Paqr7 T C 4: 134,507,603 V257A probably benign Het
Parp8 A T 13: 116,894,756 S473R probably benign Het
Pcdhb14 A T 18: 37,448,023 T61S probably benign Het
Pde11a G A 2: 75,991,268 A889V probably benign Het
Sertad1 T C 7: 27,489,446 L64P probably damaging Het
Tmem156 C T 5: 65,080,188 R43K probably damaging Het
Tmem82 T A 4: 141,615,030 D287V probably damaging Het
Traf1 A G 2: 34,943,962 F381L probably benign Het
Trim44 T C 2: 102,400,306 S127G unknown Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Ubap2 G A 4: 41,195,434 A1068V possibly damaging Het
Vmn1r47 T G 6: 90,022,795 M303R probably null Het
Zc3h12d T C 10: 7,867,557 S364P possibly damaging Het
Zdbf2 T A 1: 63,305,625 N1054K possibly damaging Het
Zpbp A T 11: 11,408,541 I242N probably damaging Het
Other mutations in Dnajc13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Dnajc13 APN 9 104162780 missense probably benign 0.15
IGL00754:Dnajc13 APN 9 104174498 nonsense probably null
IGL00914:Dnajc13 APN 9 104212882 missense possibly damaging 0.90
IGL01014:Dnajc13 APN 9 104203218 missense probably damaging 1.00
IGL01077:Dnajc13 APN 9 104231021 missense probably benign 0.11
IGL01137:Dnajc13 APN 9 104160490 missense probably benign
IGL01305:Dnajc13 APN 9 104230637 splice site probably null
IGL01707:Dnajc13 APN 9 104228979 missense probably damaging 1.00
IGL01781:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL01868:Dnajc13 APN 9 104162745 missense possibly damaging 0.83
IGL01950:Dnajc13 APN 9 104190432 missense possibly damaging 0.85
IGL02102:Dnajc13 APN 9 104229009 missense possibly damaging 0.78
IGL02350:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL02357:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL02470:Dnajc13 APN 9 104175747 missense probably benign 0.17
IGL02888:Dnajc13 APN 9 104180062 splice site probably benign
IGL03079:Dnajc13 APN 9 104212869 nonsense probably null
IGL03179:Dnajc13 APN 9 104167435 missense probably benign 0.42
IGL03293:Dnajc13 APN 9 104174426 missense possibly damaging 0.64
impressario UTSW 9 104213886 missense probably benign 0.12
Kaiser UTSW 9 104214188 missense probably damaging 1.00
BB008:Dnajc13 UTSW 9 104218564 missense probably benign 0.02
BB018:Dnajc13 UTSW 9 104218564 missense probably benign 0.02
PIT4142001:Dnajc13 UTSW 9 104238473 missense probably damaging 0.96
R0323:Dnajc13 UTSW 9 104156892 missense probably damaging 1.00
R0361:Dnajc13 UTSW 9 104167059 missense probably benign 0.18
R0480:Dnajc13 UTSW 9 104200509 missense probably damaging 0.98
R0558:Dnajc13 UTSW 9 104201952 critical splice acceptor site probably null
R0707:Dnajc13 UTSW 9 104172582 missense probably benign 0.12
R0831:Dnajc13 UTSW 9 104172612 missense probably damaging 1.00
R1234:Dnajc13 UTSW 9 104214157 missense possibly damaging 0.64
R1433:Dnajc13 UTSW 9 104180121 missense probably damaging 1.00
R1463:Dnajc13 UTSW 9 104178940 missense probably damaging 1.00
R1464:Dnajc13 UTSW 9 104214167 missense probably benign 0.10
R1464:Dnajc13 UTSW 9 104214167 missense probably benign 0.10
R1489:Dnajc13 UTSW 9 104231035 missense possibly damaging 0.94
R1575:Dnajc13 UTSW 9 104156838 missense probably benign 0.29
R1750:Dnajc13 UTSW 9 104221477 missense probably damaging 0.98
R1903:Dnajc13 UTSW 9 104228937 missense probably damaging 0.98
R2066:Dnajc13 UTSW 9 104221441 missense probably benign 0.01
R2206:Dnajc13 UTSW 9 104203518 missense probably damaging 1.00
R3160:Dnajc13 UTSW 9 104219898 missense possibly damaging 0.57
R3162:Dnajc13 UTSW 9 104219898 missense possibly damaging 0.57
R4158:Dnajc13 UTSW 9 104190442 missense probably damaging 0.96
R4460:Dnajc13 UTSW 9 104181063 missense probably damaging 0.96
R4537:Dnajc13 UTSW 9 104186805 intron probably benign
R4538:Dnajc13 UTSW 9 104186805 intron probably benign
R4631:Dnajc13 UTSW 9 104190417 missense probably damaging 1.00
R4662:Dnajc13 UTSW 9 104207758 missense probably damaging 1.00
R4722:Dnajc13 UTSW 9 104213818 missense probably benign
R4731:Dnajc13 UTSW 9 104186805 intron probably benign
R4732:Dnajc13 UTSW 9 104186805 intron probably benign
R4758:Dnajc13 UTSW 9 104172574 missense probably damaging 1.00
R4801:Dnajc13 UTSW 9 104175727 missense probably benign 0.16
R4802:Dnajc13 UTSW 9 104175727 missense probably benign 0.16
R4928:Dnajc13 UTSW 9 104233638 missense possibly damaging 0.93
R4944:Dnajc13 UTSW 9 104167387 unclassified probably benign
R4979:Dnajc13 UTSW 9 104186723 missense probably damaging 1.00
R5177:Dnajc13 UTSW 9 104230986 missense probably benign 0.39
R5190:Dnajc13 UTSW 9 104174525 missense probably benign 0.00
R5256:Dnajc13 UTSW 9 104203329 missense possibly damaging 0.86
R5452:Dnajc13 UTSW 9 104192114 missense probably benign 0.01
R5657:Dnajc13 UTSW 9 104228537 missense probably damaging 1.00
R5752:Dnajc13 UTSW 9 104192774 splice site probably null
R5789:Dnajc13 UTSW 9 104214188 missense probably damaging 1.00
R5837:Dnajc13 UTSW 9 104176666 missense possibly damaging 0.88
R5846:Dnajc13 UTSW 9 104190385 missense probably damaging 0.99
R5982:Dnajc13 UTSW 9 104184615 missense possibly damaging 0.77
R6189:Dnajc13 UTSW 9 104213886 missense probably benign 0.12
R6355:Dnajc13 UTSW 9 104203270 missense probably damaging 0.99
R6483:Dnajc13 UTSW 9 104207804 missense probably damaging 0.96
R6613:Dnajc13 UTSW 9 104213877 missense probably benign 0.07
R6962:Dnajc13 UTSW 9 104181009 missense probably benign 0.02
R7048:Dnajc13 UTSW 9 104203414 critical splice donor site probably null
R7101:Dnajc13 UTSW 9 104165022 missense possibly damaging 0.92
R7304:Dnajc13 UTSW 9 104238514 missense probably benign 0.00
R7353:Dnajc13 UTSW 9 104230031 missense possibly damaging 0.89
R7366:Dnajc13 UTSW 9 104184706 missense probably benign 0.43
R7528:Dnajc13 UTSW 9 104178965 missense possibly damaging 0.65
R7635:Dnajc13 UTSW 9 104162367 missense probably benign
R7673:Dnajc13 UTSW 9 104233692 missense probably benign 0.09
R7856:Dnajc13 UTSW 9 104167485 missense possibly damaging 0.83
R7931:Dnajc13 UTSW 9 104218564 missense probably benign 0.02
R7995:Dnajc13 UTSW 9 104174363 missense probably damaging 1.00
R8319:Dnajc13 UTSW 9 104190391 missense probably benign 0.00
R8354:Dnajc13 UTSW 9 104217728 missense probably damaging 1.00
R8680:Dnajc13 UTSW 9 104180139 missense probably benign
R8686:Dnajc13 UTSW 9 104170805 missense probably benign 0.00
R8707:Dnajc13 UTSW 9 104192648 missense probably damaging 0.96
R8847:Dnajc13 UTSW 9 104180161 nonsense probably null
R8868:Dnajc13 UTSW 9 104165788 missense probably benign 0.13
R8986:Dnajc13 UTSW 9 104180131 missense probably damaging 1.00
R9139:Dnajc13 UTSW 9 104207840 missense probably benign 0.02
R9334:Dnajc13 UTSW 9 104174460 missense probably benign 0.00
R9353:Dnajc13 UTSW 9 104190372 missense probably benign 0.31
R9528:Dnajc13 UTSW 9 104237705 missense probably benign
R9578:Dnajc13 UTSW 9 104238527 missense probably benign 0.04
X0017:Dnajc13 UTSW 9 104238478 missense possibly damaging 0.90
X0028:Dnajc13 UTSW 9 104165018 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTGTTTTGCATTCCTTAGAAAC -3'
(R):5'- AGAGCCACTGGAATTTGAGC -3'

Sequencing Primer
(F):5'- GGGGCTTCAATGTTGCAA -3'
(R):5'- CGTTTTGGGAAATACAGCACTG -3'
Posted On 2022-06-15