Incidental Mutation 'R9471:Pappa2'
ID 715443
Institutional Source Beutler Lab
Gene Symbol Pappa2
Ensembl Gene ENSMUSG00000073530
Gene Name pappalysin 2
Synonyms pregnancy-associated plasma preproprotein-A2, placenta-specific 3, pregnancy-associated plasma protein-E, PAPP-A2, PLAC3, Pappe
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9471 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 158711727-158980490 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 158814459 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 1342 (M1342I)
Ref Sequence ENSEMBL: ENSMUSP00000124022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159861]
AlphaFold E9PZ87
Predicted Effect probably benign
Transcript: ENSMUST00000159861
AA Change: M1342I

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000124022
Gene: ENSMUSG00000073530
AA Change: M1342I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Laminin_G_3 271 440 1.2e-25 PFAM
NL 572 614 2.81e-5 SMART
Pfam:Peptidase_M43 669 832 1.5e-12 PFAM
Blast:FN3 844 1103 1e-169 BLAST
low complexity region 1130 1139 N/A INTRINSIC
low complexity region 1361 1370 N/A INTRINSIC
CCP 1394 1457 4.97e0 SMART
CCP 1462 1519 4.81e-1 SMART
CCP 1523 1588 2.58e-4 SMART
CCP 1593 1644 1.13e0 SMART
NL 1720 1757 2.66e-6 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000124316
Gene: ENSMUSG00000073530
AA Change: M3I

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
CCP 67 130 4.97e0 SMART
CCP 135 192 4.81e-1 SMART
CCP 196 245 2.84e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the pappalysin family of metzincin metalloproteinases. The encoded protein cleaves insulin-like growth factor-binding protein 5 and is thought to be a local regulator of insulin-like growth factor (IGF) bioavailability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a null mutation are viable and fertile but display postnatal growth retardation that is more pronounced in females compared to males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,567,057 K368E probably damaging Het
Adgrl2 T C 3: 148,852,729 T448A probably benign Het
Aff4 C T 11: 53,380,646 P337S probably benign Het
Alg12 G A 15: 88,806,418 Q406* probably null Het
Anapc5 T C 5: 122,806,245 Y302C probably damaging Het
Apol7a A G 15: 77,389,480 S261P possibly damaging Het
Atad5 G T 11: 80,132,698 K1545N possibly damaging Het
Atp6v1f T A 6: 29,467,942 D42E probably benign Het
Bcl6 T A 16: 23,973,107 N166Y probably benign Het
Btbd7 C T 12: 102,793,886 R601Q probably damaging Het
Casp1 A G 9: 5,304,187 E287G probably benign Het
Cd300c A T 11: 114,956,390 V193E probably damaging Het
Cd300lg T A 11: 102,054,094 S377T probably benign Het
Ceacam13 T A 7: 18,019,087 *264R probably null Het
Clasrp G A 7: 19,585,247 R498* probably null Het
Clec4n T A 6: 123,244,546 N146K probably benign Het
Cntln T A 4: 85,049,782 V746E possibly damaging Het
Defa29 T C 8: 21,326,885 T31A possibly damaging Het
Egr4 A G 6: 85,512,713 S122P possibly damaging Het
Fam221a T G 6: 49,372,586 D28E probably damaging Het
Fanca G A 8: 123,274,158 T1161I possibly damaging Het
Frat2 A G 19: 41,847,674 S80P probably benign Het
Fuk T C 8: 110,883,409 E991G probably benign Het
Gm13089 T A 4: 143,697,179 T347S probably damaging Het
Gse1 C A 8: 120,575,106 S985R unknown Het
H2-M3 T A 17: 37,271,097 I148N probably damaging Het
Hs6st3 G T 14: 119,138,823 V137L probably damaging Het
Ighv1-42 T A 12: 114,937,307 M53L probably benign Het
Klhl24 C T 16: 20,122,985 T561I Het
Klhl26 C G 8: 70,452,153 G369A probably damaging Het
Klra5 C A 6: 129,906,723 W147L possibly damaging Het
Lrrd1 A T 5: 3,863,980 D750V Het
Mc5r A G 18: 68,339,056 D162G probably damaging Het
Mrc2 T A 11: 105,343,733 S1026R probably benign Het
Nf1 A G 11: 79,545,369 H1945R probably damaging Het
Nr4a2 A G 2: 57,112,102 M113T probably benign Het
Obox2 G A 7: 15,397,188 G73D probably damaging Het
Olfr330 A T 11: 58,529,529 C152* probably null Het
Olfr366 G A 2: 37,220,388 A300T probably damaging Het
Pla2g6 A T 15: 79,317,839 L44Q probably damaging Het
Pnpla1 A T 17: 28,880,999 Q280L probably benign Het
Prdm1 C T 10: 44,450,178 G117S probably damaging Het
Prss36 A T 7: 127,946,433 F6I probably benign Het
Sat2 A G 11: 69,622,899 Y81C probably damaging Het
Sbspon T C 1: 15,892,453 D67G probably benign Het
Shank2 G A 7: 144,411,015 V787M possibly damaging Het
Stoml1 A T 9: 58,256,685 I96F probably damaging Het
Tet2 C T 3: 133,485,919 G918D probably damaging Het
Tgm4 A G 9: 123,040,379 I8V probably benign Het
Tmem156 C T 5: 65,080,188 R43K probably damaging Het
Trim44 T C 2: 102,400,306 S127G unknown Het
Ttn C T 2: 76,768,502 V19356M probably damaging Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Vmn2r67 A C 7: 85,150,515 probably null Het
Wdr90 C A 17: 25,861,041 V107L possibly damaging Het
Zfp316 T C 5: 143,255,406 D286G unknown Het
Zfp981 C A 4: 146,537,623 P335Q probably benign Het
Zscan18 T C 7: 12,774,416 T386A possibly damaging Het
Other mutations in Pappa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Pappa2 APN 1 158857148 missense probably damaging 1.00
IGL01394:Pappa2 APN 1 158765104 splice site probably benign
IGL01570:Pappa2 APN 1 158814540 nonsense probably null
IGL01618:Pappa2 APN 1 158857378 missense probably damaging 1.00
IGL01717:Pappa2 APN 1 158857132 critical splice donor site probably null
IGL01804:Pappa2 APN 1 158936519 missense probably benign
IGL01904:Pappa2 APN 1 158783941 missense probably damaging 0.99
IGL02116:Pappa2 APN 1 158845125 missense probably benign 0.01
IGL02174:Pappa2 APN 1 158761618 missense probably damaging 1.00
IGL02302:Pappa2 APN 1 158715001 missense probably benign 0.38
IGL02422:Pappa2 APN 1 158936933 missense probably damaging 1.00
IGL02572:Pappa2 APN 1 158851216 missense probably benign
IGL02659:Pappa2 APN 1 158936794 missense probably damaging 0.97
IGL02887:Pappa2 APN 1 158782259 missense probably damaging 1.00
IGL02981:Pappa2 APN 1 158851144 missense probably benign 0.00
IGL03128:Pappa2 APN 1 158936484 missense probably benign 0.16
IGL03142:Pappa2 APN 1 158854931 missense probably damaging 1.00
IGL03270:Pappa2 APN 1 158765067 missense possibly damaging 0.78
Fritas UTSW 1 158847963 missense possibly damaging 0.77
Gulliver UTSW 1 158857136 missense probably null 1.00
Lilliputian UTSW 1 158716990 missense probably damaging 1.00
Lilliputian2 UTSW 1 158834918 nonsense probably null
lilliputian3 UTSW 1 158782403 splice site probably null
Pitzel UTSW 1 158956645 missense probably damaging 1.00
shrink UTSW 1 158763192 missense probably damaging 1.00
R0106:Pappa2 UTSW 1 158714977 missense probably damaging 1.00
R0106:Pappa2 UTSW 1 158714977 missense probably damaging 1.00
R0172:Pappa2 UTSW 1 158854849 critical splice donor site probably null
R0194:Pappa2 UTSW 1 158765101 splice site probably benign
R0418:Pappa2 UTSW 1 158716990 missense probably damaging 1.00
R0421:Pappa2 UTSW 1 158848080 missense probably damaging 1.00
R0441:Pappa2 UTSW 1 158763058 unclassified probably benign
R0602:Pappa2 UTSW 1 158763055 unclassified probably benign
R0630:Pappa2 UTSW 1 158832773 missense probably benign
R0760:Pappa2 UTSW 1 158716961 critical splice donor site probably null
R1146:Pappa2 UTSW 1 158854982 missense probably damaging 1.00
R1146:Pappa2 UTSW 1 158854982 missense probably damaging 1.00
R1243:Pappa2 UTSW 1 158845100 missense probably damaging 1.00
R1413:Pappa2 UTSW 1 158936554 missense probably benign 0.00
R1502:Pappa2 UTSW 1 158957288 missense probably damaging 1.00
R1599:Pappa2 UTSW 1 158857172 missense probably damaging 1.00
R1689:Pappa2 UTSW 1 158957398 missense probably damaging 1.00
R1750:Pappa2 UTSW 1 158763150 nonsense probably null
R1772:Pappa2 UTSW 1 158814368 missense possibly damaging 0.92
R1832:Pappa2 UTSW 1 158857316 missense probably damaging 1.00
R1905:Pappa2 UTSW 1 158803503 splice site probably null
R1914:Pappa2 UTSW 1 158750563 missense probably damaging 0.97
R2013:Pappa2 UTSW 1 158834928 missense probably damaging 1.00
R2037:Pappa2 UTSW 1 158956644 nonsense probably null
R2118:Pappa2 UTSW 1 158857266 missense probably damaging 1.00
R2268:Pappa2 UTSW 1 158857271 missense probably damaging 1.00
R2269:Pappa2 UTSW 1 158857271 missense probably damaging 1.00
R2347:Pappa2 UTSW 1 158765043 missense probably damaging 1.00
R3024:Pappa2 UTSW 1 158936225 missense probably benign 0.00
R3706:Pappa2 UTSW 1 158834918 nonsense probably null
R3707:Pappa2 UTSW 1 158834918 nonsense probably null
R3708:Pappa2 UTSW 1 158834918 nonsense probably null
R4600:Pappa2 UTSW 1 158814445 missense probably damaging 1.00
R4737:Pappa2 UTSW 1 158957012 missense probably benign
R4738:Pappa2 UTSW 1 158957012 missense probably benign
R4739:Pappa2 UTSW 1 158957002 missense probably damaging 0.99
R4739:Pappa2 UTSW 1 158957012 missense probably benign
R4788:Pappa2 UTSW 1 158783917 missense possibly damaging 0.86
R4798:Pappa2 UTSW 1 158857379 missense probably damaging 0.99
R4952:Pappa2 UTSW 1 158857136 missense probably null 1.00
R5121:Pappa2 UTSW 1 158838627 missense probably benign 0.01
R5144:Pappa2 UTSW 1 158957133 missense probably benign 0.03
R5159:Pappa2 UTSW 1 158761619 missense probably damaging 1.00
R5278:Pappa2 UTSW 1 158782403 splice site probably null
R5428:Pappa2 UTSW 1 158814785 missense possibly damaging 0.53
R5452:Pappa2 UTSW 1 158838602 missense probably benign 0.00
R5477:Pappa2 UTSW 1 158956738 missense probably benign 0.00
R5504:Pappa2 UTSW 1 158848045 missense probably benign 0.00
R5852:Pappa2 UTSW 1 158717014 missense probably damaging 1.00
R6003:Pappa2 UTSW 1 158936250 missense probably benign 0.23
R6129:Pappa2 UTSW 1 158714997 nonsense probably null
R6137:Pappa2 UTSW 1 158871543 missense probably damaging 1.00
R6374:Pappa2 UTSW 1 158956645 missense probably damaging 1.00
R6472:Pappa2 UTSW 1 158834799 missense probably damaging 1.00
R6804:Pappa2 UTSW 1 158936868 missense probably benign 0.24
R7020:Pappa2 UTSW 1 158848009 missense probably damaging 0.98
R7051:Pappa2 UTSW 1 158957183 missense unknown
R7082:Pappa2 UTSW 1 158763119 missense possibly damaging 0.65
R7111:Pappa2 UTSW 1 158956526 missense probably benign 0.38
R7213:Pappa2 UTSW 1 158936886 missense possibly damaging 0.93
R7575:Pappa2 UTSW 1 158814530 missense probably damaging 1.00
R7587:Pappa2 UTSW 1 158851131 missense probably damaging 1.00
R7826:Pappa2 UTSW 1 158936440 nonsense probably null
R7957:Pappa2 UTSW 1 158761561 nonsense probably null
R8007:Pappa2 UTSW 1 158782304 missense probably damaging 0.99
R8050:Pappa2 UTSW 1 158848400 missense probably damaging 1.00
R8063:Pappa2 UTSW 1 158936556 missense possibly damaging 0.79
R8068:Pappa2 UTSW 1 158935985 missense possibly damaging 0.87
R8128:Pappa2 UTSW 1 158936664 missense possibly damaging 0.75
R8264:Pappa2 UTSW 1 158854973 missense probably damaging 1.00
R8317:Pappa2 UTSW 1 158764960 missense probably damaging 1.00
R8499:Pappa2 UTSW 1 158936522 missense probably damaging 1.00
R8744:Pappa2 UTSW 1 158783917 missense possibly damaging 0.86
R8793:Pappa2 UTSW 1 158851161 missense probably damaging 1.00
R8932:Pappa2 UTSW 1 158763192 missense probably damaging 1.00
R9004:Pappa2 UTSW 1 158936409 missense probably damaging 1.00
R9004:Pappa2 UTSW 1 158936948 missense possibly damaging 0.67
R9088:Pappa2 UTSW 1 158936357 missense probably damaging 1.00
R9191:Pappa2 UTSW 1 158857418 missense probably damaging 1.00
R9243:Pappa2 UTSW 1 158936193 missense probably damaging 0.99
R9280:Pappa2 UTSW 1 158847963 missense possibly damaging 0.77
R9301:Pappa2 UTSW 1 158845044 missense probably damaging 0.96
R9306:Pappa2 UTSW 1 158936922 missense probably damaging 1.00
R9367:Pappa2 UTSW 1 158956972 missense probably benign 0.40
R9544:Pappa2 UTSW 1 158957247 missense probably damaging 0.99
R9680:Pappa2 UTSW 1 158782248 missense possibly damaging 0.78
R9762:Pappa2 UTSW 1 158857378 missense probably damaging 1.00
R9774:Pappa2 UTSW 1 158848350 missense probably damaging 0.99
R9776:Pappa2 UTSW 1 158783911 missense probably damaging 1.00
X0058:Pappa2 UTSW 1 158814397 missense probably null
X0061:Pappa2 UTSW 1 158936618 missense possibly damaging 0.87
Z1176:Pappa2 UTSW 1 158814814 missense probably damaging 1.00
Z1176:Pappa2 UTSW 1 158814816 missense probably damaging 1.00
Z1176:Pappa2 UTSW 1 158956933 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGTAGTCACAAGGGCACTG -3'
(R):5'- AGTAGGCTCCGGAGTCAGTTTG -3'

Sequencing Primer
(F):5'- TCACAAGGGCACTGGGAGAAAAG -3'
(R):5'- CCGGAGTCAGTTTGGTATTGACATC -3'
Posted On 2022-06-15