Incidental Mutation 'R9471:Cntln'
ID 715450
Institutional Source Beutler Lab
Gene Symbol Cntln
Ensembl Gene ENSMUSG00000038070
Gene Name centlein, centrosomal protein
Synonyms D530005L17Rik, B430108F07Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.317) question?
Stock # R9471 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 84802546-85050158 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 84968019 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 746 (V746E)
Ref Sequence ENSEMBL: ENSMUSP00000044138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047023] [ENSMUST00000169371]
AlphaFold A2AM05
Predicted Effect possibly damaging
Transcript: ENSMUST00000047023
AA Change: V746E

PolyPhen 2 Score 0.619 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000044138
Gene: ENSMUSG00000038070
AA Change: V746E

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.25e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.25e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 973 1114 N/A INTRINSIC
low complexity region 1206 1217 N/A INTRINSIC
Blast:HisKA 1270 1326 1e-24 BLAST
low complexity region 1327 1348 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169371
AA Change: V746E

PolyPhen 2 Score 0.748 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000130491
Gene: ENSMUSG00000038070
AA Change: V746E

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.24e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.24e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 972 1113 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
Blast:HisKA 1269 1325 1e-24 BLAST
low complexity region 1326 1347 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,565,319 (GRCm39) K368E probably damaging Het
Adgrl2 T C 3: 148,558,365 (GRCm39) T448A probably benign Het
Aff4 C T 11: 53,271,473 (GRCm39) P337S probably benign Het
Alg12 G A 15: 88,690,621 (GRCm39) Q406* probably null Het
Anapc5 T C 5: 122,944,308 (GRCm39) Y302C probably damaging Het
Apol7a A G 15: 77,273,680 (GRCm39) S261P possibly damaging Het
Atad5 G T 11: 80,023,524 (GRCm39) K1545N possibly damaging Het
Atp6v1f T A 6: 29,467,941 (GRCm39) D42E probably benign Het
Bcl6 T A 16: 23,791,857 (GRCm39) N166Y probably benign Het
Btbd7 C T 12: 102,760,145 (GRCm39) R601Q probably damaging Het
Casp1 A G 9: 5,304,187 (GRCm39) E287G probably benign Het
Cd300c A T 11: 114,847,216 (GRCm39) V193E probably damaging Het
Cd300lg T A 11: 101,944,920 (GRCm39) S377T probably benign Het
Ceacam13 T A 7: 17,753,012 (GRCm39) *264R probably null Het
Clasrp G A 7: 19,319,172 (GRCm39) R498* probably null Het
Clec4n T A 6: 123,221,505 (GRCm39) N146K probably benign Het
Defa29 T C 8: 21,816,901 (GRCm39) T31A possibly damaging Het
Egr4 A G 6: 85,489,695 (GRCm39) S122P possibly damaging Het
Fam221a T G 6: 49,349,520 (GRCm39) D28E probably damaging Het
Fanca G A 8: 124,000,897 (GRCm39) T1161I possibly damaging Het
Fcsk T C 8: 111,610,041 (GRCm39) E991G probably benign Het
Frat2 A G 19: 41,836,113 (GRCm39) S80P probably benign Het
Gse1 C A 8: 121,301,845 (GRCm39) S985R unknown Het
H2-M3 T A 17: 37,581,988 (GRCm39) I148N probably damaging Het
Hs6st3 G T 14: 119,376,235 (GRCm39) V137L probably damaging Het
Ighv1-42 T A 12: 114,900,927 (GRCm39) M53L probably benign Het
Klhl24 C T 16: 19,941,735 (GRCm39) T561I Het
Klhl26 C G 8: 70,904,803 (GRCm39) G369A probably damaging Het
Klra5 C A 6: 129,883,686 (GRCm39) W147L possibly damaging Het
Lrrd1 A T 5: 3,913,980 (GRCm39) D750V Het
Mc5r A G 18: 68,472,127 (GRCm39) D162G probably damaging Het
Mrc2 T A 11: 105,234,559 (GRCm39) S1026R probably benign Het
Nf1 A G 11: 79,436,195 (GRCm39) H1945R probably damaging Het
Nr4a2 A G 2: 57,002,114 (GRCm39) M113T probably benign Het
Obox2 G A 7: 15,131,113 (GRCm39) G73D probably damaging Het
Or1af1 G A 2: 37,110,400 (GRCm39) A300T probably damaging Het
Or2t48 A T 11: 58,420,355 (GRCm39) C152* probably null Het
Pappa2 C T 1: 158,642,029 (GRCm39) M1342I probably benign Het
Pla2g6 A T 15: 79,202,039 (GRCm39) L44Q probably damaging Het
Pnpla1 A T 17: 29,099,973 (GRCm39) Q280L probably benign Het
Pramel23 T A 4: 143,423,749 (GRCm39) T347S probably damaging Het
Prdm1 C T 10: 44,326,174 (GRCm39) G117S probably damaging Het
Prss36 A T 7: 127,545,605 (GRCm39) F6I probably benign Het
Sat2 A G 11: 69,513,725 (GRCm39) Y81C probably damaging Het
Sbspon T C 1: 15,962,677 (GRCm39) D67G probably benign Het
Shank2 G A 7: 143,964,752 (GRCm39) V787M possibly damaging Het
Stoml1 A T 9: 58,163,968 (GRCm39) I96F probably damaging Het
Tet2 C T 3: 133,191,680 (GRCm39) G918D probably damaging Het
Tgm4 A G 9: 122,869,444 (GRCm39) I8V probably benign Het
Tmem156 C T 5: 65,237,531 (GRCm39) R43K probably damaging Het
Trim44 T C 2: 102,230,651 (GRCm39) S127G unknown Het
Ttn C T 2: 76,598,846 (GRCm39) V19356M probably damaging Het
Tyw1 G A 5: 130,298,065 (GRCm39) R202Q probably damaging Het
Vmn2r67 A C 7: 84,799,723 (GRCm39) probably null Het
Wdr90 C A 17: 26,080,015 (GRCm39) V107L possibly damaging Het
Zfp316 T C 5: 143,241,161 (GRCm39) D286G unknown Het
Zfp981 C A 4: 146,622,080 (GRCm39) P335Q probably benign Het
Zscan18 T C 7: 12,508,343 (GRCm39) T386A possibly damaging Het
Other mutations in Cntln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Cntln APN 4 84,924,671 (GRCm39) missense probably benign 0.25
IGL00743:Cntln APN 4 84,897,652 (GRCm39) missense probably benign 0.06
IGL01014:Cntln APN 4 84,968,145 (GRCm39) missense probably benign 0.25
IGL02217:Cntln APN 4 85,018,495 (GRCm39) missense probably damaging 1.00
IGL02323:Cntln APN 4 84,968,026 (GRCm39) missense probably benign 0.00
IGL02353:Cntln APN 4 84,968,087 (GRCm39) missense probably damaging 0.98
IGL02360:Cntln APN 4 84,968,087 (GRCm39) missense probably damaging 0.98
IGL02616:Cntln APN 4 85,033,689 (GRCm39) critical splice donor site probably null
PIT4696001:Cntln UTSW 4 84,892,237 (GRCm39) missense probably damaging 0.99
R0110:Cntln UTSW 4 85,014,994 (GRCm39) missense probably damaging 1.00
R0324:Cntln UTSW 4 85,010,932 (GRCm39) missense probably damaging 0.98
R0349:Cntln UTSW 4 84,914,722 (GRCm39) missense probably damaging 1.00
R0519:Cntln UTSW 4 84,923,290 (GRCm39) splice site probably benign
R0529:Cntln UTSW 4 84,986,062 (GRCm39) missense probably damaging 1.00
R0582:Cntln UTSW 4 84,802,978 (GRCm39) missense probably damaging 1.00
R1077:Cntln UTSW 4 84,914,716 (GRCm39) missense probably damaging 1.00
R1345:Cntln UTSW 4 84,892,228 (GRCm39) missense probably damaging 1.00
R1457:Cntln UTSW 4 85,015,076 (GRCm39) missense probably benign 0.33
R1571:Cntln UTSW 4 84,865,823 (GRCm39) nonsense probably null
R1622:Cntln UTSW 4 84,981,418 (GRCm39) missense probably damaging 1.00
R1681:Cntln UTSW 4 84,865,872 (GRCm39) missense probably damaging 1.00
R1777:Cntln UTSW 4 85,048,916 (GRCm39) missense probably benign 0.23
R1808:Cntln UTSW 4 85,015,000 (GRCm39) missense probably damaging 1.00
R1882:Cntln UTSW 4 85,019,072 (GRCm39) missense probably damaging 1.00
R2056:Cntln UTSW 4 84,967,911 (GRCm39) missense probably benign
R2965:Cntln UTSW 4 84,892,264 (GRCm39) critical splice donor site probably null
R2968:Cntln UTSW 4 84,875,504 (GRCm39) missense probably benign 0.27
R3104:Cntln UTSW 4 84,875,406 (GRCm39) missense possibly damaging 0.95
R3106:Cntln UTSW 4 84,875,406 (GRCm39) missense possibly damaging 0.95
R3121:Cntln UTSW 4 84,923,289 (GRCm39) splice site probably benign
R3617:Cntln UTSW 4 84,923,214 (GRCm39) nonsense probably null
R4009:Cntln UTSW 4 84,981,452 (GRCm39) missense probably benign 0.45
R4036:Cntln UTSW 4 84,924,725 (GRCm39) missense probably damaging 1.00
R4548:Cntln UTSW 4 85,015,079 (GRCm39) missense probably benign 0.27
R4592:Cntln UTSW 4 84,889,419 (GRCm39) missense probably benign 0.00
R4666:Cntln UTSW 4 84,889,453 (GRCm39) missense probably benign 0.13
R4826:Cntln UTSW 4 84,923,281 (GRCm39) missense probably benign 0.03
R4836:Cntln UTSW 4 84,967,957 (GRCm39) nonsense probably null
R4856:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R4886:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R4995:Cntln UTSW 4 84,968,120 (GRCm39) missense probably benign 0.00
R5090:Cntln UTSW 4 84,865,830 (GRCm39) missense probably damaging 0.98
R5202:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R5905:Cntln UTSW 4 84,889,410 (GRCm39) missense probably benign 0.03
R5953:Cntln UTSW 4 84,968,156 (GRCm39) missense possibly damaging 0.92
R6028:Cntln UTSW 4 84,889,410 (GRCm39) missense probably benign 0.03
R6298:Cntln UTSW 4 85,014,998 (GRCm39) missense probably damaging 1.00
R6351:Cntln UTSW 4 85,033,591 (GRCm39) missense probably damaging 0.99
R6371:Cntln UTSW 4 84,802,816 (GRCm39) missense probably damaging 0.98
R6481:Cntln UTSW 4 84,985,747 (GRCm39) missense probably benign 0.00
R6864:Cntln UTSW 4 85,015,029 (GRCm39) missense probably damaging 0.99
R6874:Cntln UTSW 4 84,985,996 (GRCm39) missense probably damaging 1.00
R6919:Cntln UTSW 4 85,033,605 (GRCm39) missense probably benign 0.04
R7071:Cntln UTSW 4 85,018,622 (GRCm39) missense probably damaging 1.00
R7113:Cntln UTSW 4 84,968,064 (GRCm39) missense probably damaging 0.98
R7152:Cntln UTSW 4 84,802,937 (GRCm39) missense possibly damaging 0.87
R7253:Cntln UTSW 4 85,036,710 (GRCm39) missense probably damaging 1.00
R7289:Cntln UTSW 4 84,964,540 (GRCm39) missense possibly damaging 0.80
R7440:Cntln UTSW 4 84,981,453 (GRCm39) missense possibly damaging 0.95
R7670:Cntln UTSW 4 84,897,577 (GRCm39) missense possibly damaging 0.66
R7707:Cntln UTSW 4 84,802,853 (GRCm39) missense probably damaging 1.00
R7895:Cntln UTSW 4 84,981,561 (GRCm39) missense possibly damaging 0.91
R8176:Cntln UTSW 4 84,806,926 (GRCm39) missense probably damaging 0.99
R8247:Cntln UTSW 4 85,019,017 (GRCm39) missense probably benign 0.39
R8264:Cntln UTSW 4 85,016,648 (GRCm39) missense probably damaging 1.00
R8293:Cntln UTSW 4 84,952,075 (GRCm39) missense probably damaging 1.00
R8536:Cntln UTSW 4 84,875,286 (GRCm39) missense probably damaging 1.00
R8844:Cntln UTSW 4 84,892,234 (GRCm39) missense probably damaging 1.00
R8924:Cntln UTSW 4 84,806,936 (GRCm39) missense probably damaging 1.00
R8955:Cntln UTSW 4 84,986,110 (GRCm39) missense possibly damaging 0.85
R8960:Cntln UTSW 4 85,018,961 (GRCm39) missense possibly damaging 0.59
R8979:Cntln UTSW 4 85,048,910 (GRCm39) missense probably damaging 1.00
R9255:Cntln UTSW 4 85,019,103 (GRCm39) missense possibly damaging 0.93
R9314:Cntln UTSW 4 84,924,719 (GRCm39) missense probably damaging 1.00
R9353:Cntln UTSW 4 84,802,597 (GRCm39) unclassified probably benign
R9361:Cntln UTSW 4 84,968,151 (GRCm39) missense probably benign 0.23
R9376:Cntln UTSW 4 84,875,258 (GRCm39) missense probably benign 0.24
R9382:Cntln UTSW 4 84,968,318 (GRCm39) missense probably benign 0.13
R9478:Cntln UTSW 4 84,897,630 (GRCm39) missense probably benign 0.00
R9527:Cntln UTSW 4 84,892,120 (GRCm39) missense probably damaging 1.00
R9788:Cntln UTSW 4 84,968,093 (GRCm39) missense probably damaging 1.00
R9793:Cntln UTSW 4 84,985,798 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTCATTGAGTTGGAAAATCGG -3'
(R):5'- TCACCTTGGTAGTGGCTGTC -3'

Sequencing Primer
(F):5'- TGAGTTGGAAAATCGGCTAAAATC -3'
(R):5'- ACATCTGTGGTGGCCATCTCAG -3'
Posted On 2022-06-15