Mutagenetix > Incidental Mutation

Incidental Mutation 'R9471:Cntln'

715450

Institutional Source

Beutler Lab

Gene Symbol

Cntln

Ensembl Gene

ENSMUSG00000038070

Gene Name

centlein, centrosomal protein

Synonyms

B430108F07Rik, D530005L17Rik

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.298) question?

Stock #

R9471 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

84884309-85131921 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 85049782 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 746 (V746E)

Ref Sequence

ENSEMBL: ENSMUSP00000044138 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047023] [ENSMUST00000169371]

AlphaFold

A2AM05

Predicted Effect

possibly damaging
Transcript: ENSMUST00000047023
AA Change: V746E

PolyPhen 2 Score 0.619 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000044138
Gene: ENSMUSG00000038070
AA Change: V746E

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	58	86	N/A	INTRINSIC
coiled coil region	96	126	N/A	INTRINSIC
internal_repeat_1	198	219	1.25e-5	PROSPERO
low complexity region	242	251	N/A	INTRINSIC
internal_repeat_1	321	342	1.25e-5	PROSPERO
low complexity region	346	358	N/A	INTRINSIC
coiled coil region	404	433	N/A	INTRINSIC
low complexity region	434	446	N/A	INTRINSIC
coiled coil region	458	481	N/A	INTRINSIC
coiled coil region	516	584	N/A	INTRINSIC
coiled coil region	606	648	N/A	INTRINSIC
coiled coil region	674	780	N/A	INTRINSIC
low complexity region	815	829	N/A	INTRINSIC
coiled coil region	973	1114	N/A	INTRINSIC
low complexity region	1206	1217	N/A	INTRINSIC
Blast:HisKA	1270	1326	1e-24	BLAST
low complexity region	1327	1348	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169371
AA Change: V746E

PolyPhen 2 Score 0.748 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000130491
Gene: ENSMUSG00000038070
AA Change: V746E

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	58	86	N/A	INTRINSIC
coiled coil region	96	126	N/A	INTRINSIC
internal_repeat_1	198	219	1.24e-5	PROSPERO
low complexity region	242	251	N/A	INTRINSIC
internal_repeat_1	321	342	1.24e-5	PROSPERO
low complexity region	346	358	N/A	INTRINSIC
coiled coil region	404	433	N/A	INTRINSIC
low complexity region	434	446	N/A	INTRINSIC
coiled coil region	458	481	N/A	INTRINSIC
coiled coil region	516	584	N/A	INTRINSIC
coiled coil region	606	648	N/A	INTRINSIC
coiled coil region	674	780	N/A	INTRINSIC
low complexity region	815	829	N/A	INTRINSIC
coiled coil region	972	1113	N/A	INTRINSIC
low complexity region	1205	1216	N/A	INTRINSIC
Blast:HisKA	1269	1325	1e-24	BLAST
low complexity region	1326	1347	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actl6b	A	G	5: 137,567,057	K368E	probably damaging	Het
Adgrl2	T	C	3: 148,852,729	T448A	probably benign	Het
Aff4	C	T	11: 53,380,646	P337S	probably benign	Het
Alg12	G	A	15: 88,806,418	Q406*	probably null	Het
Anapc5	T	C	5: 122,806,245	Y302C	probably damaging	Het
Apol7a	A	G	15: 77,389,480	S261P	possibly damaging	Het
Atad5	G	T	11: 80,132,698	K1545N	possibly damaging	Het
Atp6v1f	T	A	6: 29,467,942	D42E	probably benign	Het
Bcl6	T	A	16: 23,973,107	N166Y	probably benign	Het
Btbd7	C	T	12: 102,793,886	R601Q	probably damaging	Het
Casp1	A	G	9: 5,304,187	E287G	probably benign	Het
Cd300c	A	T	11: 114,956,390	V193E	probably damaging	Het
Cd300lg	T	A	11: 102,054,094	S377T	probably benign	Het
Ceacam13	T	A	7: 18,019,087	*264R	probably null	Het
Clasrp	G	A	7: 19,585,247	R498*	probably null	Het
Clec4n	T	A	6: 123,244,546	N146K	probably benign	Het
Defa29	T	C	8: 21,326,885	T31A	possibly damaging	Het
Egr4	A	G	6: 85,512,713	S122P	possibly damaging	Het
Fam221a	T	G	6: 49,372,586	D28E	probably damaging	Het
Fanca	G	A	8: 123,274,158	T1161I	possibly damaging	Het
Frat2	A	G	19: 41,847,674	S80P	probably benign	Het
Fuk	T	C	8: 110,883,409	E991G	probably benign	Het
Gm13089	T	A	4: 143,697,179	T347S	probably damaging	Het
Gse1	C	A	8: 120,575,106	S985R	unknown	Het
H2-M3	T	A	17: 37,271,097	I148N	probably damaging	Het
Hs6st3	G	T	14: 119,138,823	V137L	probably damaging	Het
Ighv1-42	T	A	12: 114,937,307	M53L	probably benign	Het
Klhl24	C	T	16: 20,122,985	T561I		Het
Klhl26	C	G	8: 70,452,153	G369A	probably damaging	Het
Klra5	C	A	6: 129,906,723	W147L	possibly damaging	Het
Lrrd1	A	T	5: 3,863,980	D750V		Het
Mc5r	A	G	18: 68,339,056	D162G	probably damaging	Het
Mrc2	T	A	11: 105,343,733	S1026R	probably benign	Het
Nf1	A	G	11: 79,545,369	H1945R	probably damaging	Het
Nr4a2	A	G	2: 57,112,102	M113T	probably benign	Het
Obox2	G	A	7: 15,397,188	G73D	probably damaging	Het
Olfr330	A	T	11: 58,529,529	C152*	probably null	Het
Olfr366	G	A	2: 37,220,388	A300T	probably damaging	Het
Pappa2	C	T	1: 158,814,459	M1342I	probably benign	Het
Pla2g6	A	T	15: 79,317,839	L44Q	probably damaging	Het
Pnpla1	A	T	17: 28,880,999	Q280L	probably benign	Het
Prdm1	C	T	10: 44,450,178	G117S	probably damaging	Het
Prss36	A	T	7: 127,946,433	F6I	probably benign	Het
Sat2	A	G	11: 69,622,899	Y81C	probably damaging	Het
Sbspon	T	C	1: 15,892,453	D67G	probably benign	Het
Shank2	G	A	7: 144,411,015	V787M	possibly damaging	Het
Stoml1	A	T	9: 58,256,685	I96F	probably damaging	Het
Tet2	C	T	3: 133,485,919	G918D	probably damaging	Het
Tgm4	A	G	9: 123,040,379	I8V	probably benign	Het
Tmem156	C	T	5: 65,080,188	R43K	probably damaging	Het
Trim44	T	C	2: 102,400,306	S127G	unknown	Het
Ttn	C	T	2: 76,768,502	V19356M	probably damaging	Het
Tyw1	G	A	5: 130,269,224	R202Q	probably damaging	Het
Vmn2r67	A	C	7: 85,150,515		probably null	Het
Wdr90	C	A	17: 25,861,041	V107L	possibly damaging	Het
Zfp316	T	C	5: 143,255,406	D286G	unknown	Het
Zfp981	C	A	4: 146,537,623	P335Q	probably benign	Het
Zscan18	T	C	7: 12,774,416	T386A	possibly damaging	Het

Other mutations in Cntln

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00639:Cntln	APN	4	85006434	missense	probably benign	0.25
IGL00743:Cntln	APN	4	84979415	missense	probably benign	0.06
IGL01014:Cntln	APN	4	85049908	missense	probably benign	0.25
IGL02217:Cntln	APN	4	85100258	missense	probably damaging	1.00
IGL02323:Cntln	APN	4	85049789	missense	probably benign	0.00
IGL02353:Cntln	APN	4	85049850	missense	probably damaging	0.98
IGL02360:Cntln	APN	4	85049850	missense	probably damaging	0.98
IGL02616:Cntln	APN	4	85115452	critical splice donor site	probably null
PIT4696001:Cntln	UTSW	4	84974000	missense	probably damaging	0.99
R0110:Cntln	UTSW	4	85096757	missense	probably damaging	1.00
R0324:Cntln	UTSW	4	85092695	missense	probably damaging	0.98
R0349:Cntln	UTSW	4	84996485	missense	probably damaging	1.00
R0519:Cntln	UTSW	4	85005053	splice site	probably benign
R0529:Cntln	UTSW	4	85067825	missense	probably damaging	1.00
R0582:Cntln	UTSW	4	84884741	missense	probably damaging	1.00
R1077:Cntln	UTSW	4	84996479	missense	probably damaging	1.00
R1345:Cntln	UTSW	4	84973991	missense	probably damaging	1.00
R1457:Cntln	UTSW	4	85096839	missense	probably benign	0.33
R1571:Cntln	UTSW	4	84947586	nonsense	probably null
R1622:Cntln	UTSW	4	85063181	missense	probably damaging	1.00
R1681:Cntln	UTSW	4	84947635	missense	probably damaging	1.00
R1777:Cntln	UTSW	4	85130679	missense	probably benign	0.23
R1808:Cntln	UTSW	4	85096763	missense	probably damaging	1.00
R1882:Cntln	UTSW	4	85100835	missense	probably damaging	1.00
R2056:Cntln	UTSW	4	85049674	missense	probably benign
R2965:Cntln	UTSW	4	84974027	critical splice donor site	probably null
R2968:Cntln	UTSW	4	84957267	missense	probably benign	0.27
R3104:Cntln	UTSW	4	84957169	missense	possibly damaging	0.95
R3106:Cntln	UTSW	4	84957169	missense	possibly damaging	0.95
R3121:Cntln	UTSW	4	85005052	splice site	probably benign
R3617:Cntln	UTSW	4	85004977	nonsense	probably null
R4009:Cntln	UTSW	4	85063215	missense	probably benign	0.45
R4036:Cntln	UTSW	4	85006488	missense	probably damaging	1.00
R4548:Cntln	UTSW	4	85096842	missense	probably benign	0.27
R4592:Cntln	UTSW	4	84971182	missense	probably benign	0.00
R4666:Cntln	UTSW	4	84971216	missense	probably benign	0.13
R4826:Cntln	UTSW	4	85005044	missense	probably benign	0.03
R4836:Cntln	UTSW	4	85049720	nonsense	probably null
R4856:Cntln	UTSW	4	84971229	missense	probably benign	0.35
R4886:Cntln	UTSW	4	84971229	missense	probably benign	0.35
R4995:Cntln	UTSW	4	85049883	missense	probably benign	0.00
R5090:Cntln	UTSW	4	84947593	missense	probably damaging	0.98
R5202:Cntln	UTSW	4	84971229	missense	probably benign	0.35
R5905:Cntln	UTSW	4	84971173	missense	probably benign	0.03
R5953:Cntln	UTSW	4	85049919	missense	possibly damaging	0.92
R6028:Cntln	UTSW	4	84971173	missense	probably benign	0.03
R6298:Cntln	UTSW	4	85096761	missense	probably damaging	1.00
R6351:Cntln	UTSW	4	85115354	missense	probably damaging	0.99
R6371:Cntln	UTSW	4	84884579	missense	probably damaging	0.98
R6481:Cntln	UTSW	4	85067510	missense	probably benign	0.00
R6864:Cntln	UTSW	4	85096792	missense	probably damaging	0.99
R6874:Cntln	UTSW	4	85067759	missense	probably damaging	1.00
R6919:Cntln	UTSW	4	85115368	missense	probably benign	0.04
R7071:Cntln	UTSW	4	85100385	missense	probably damaging	1.00
R7113:Cntln	UTSW	4	85049827	missense	probably damaging	0.98
R7152:Cntln	UTSW	4	84884700	missense	possibly damaging	0.87
R7253:Cntln	UTSW	4	85118473	missense	probably damaging	1.00
R7289:Cntln	UTSW	4	85046303	missense	possibly damaging	0.80
R7440:Cntln	UTSW	4	85063216	missense	possibly damaging	0.95
R7670:Cntln	UTSW	4	84979340	missense	possibly damaging	0.66
R7707:Cntln	UTSW	4	84884616	missense	probably damaging	1.00
R7895:Cntln	UTSW	4	85063324	missense	possibly damaging	0.91
R8176:Cntln	UTSW	4	84888689	missense	probably damaging	0.99
R8247:Cntln	UTSW	4	85100780	missense	probably benign	0.39
R8264:Cntln	UTSW	4	85098411	missense	probably damaging	1.00
R8293:Cntln	UTSW	4	85033838	missense	probably damaging	1.00
R8536:Cntln	UTSW	4	84957049	missense	probably damaging	1.00
R8844:Cntln	UTSW	4	84973997	missense	probably damaging	1.00
R8924:Cntln	UTSW	4	84888699	missense	probably damaging	1.00
R8955:Cntln	UTSW	4	85067873	missense	possibly damaging	0.85
R8960:Cntln	UTSW	4	85100724	missense	possibly damaging	0.59
R8979:Cntln	UTSW	4	85130673	missense	probably damaging	1.00
R9255:Cntln	UTSW	4	85100866	missense	possibly damaging	0.93
R9314:Cntln	UTSW	4	85006482	missense	probably damaging	1.00
R9353:Cntln	UTSW	4	84884360	unclassified	probably benign
R9361:Cntln	UTSW	4	85049914	missense	probably benign	0.23
R9376:Cntln	UTSW	4	84957021	missense	probably benign	0.24
R9382:Cntln	UTSW	4	85050081	missense	probably benign	0.13
R9478:Cntln	UTSW	4	84979393	missense	probably benign	0.00
R9527:Cntln	UTSW	4	84973883	missense	probably damaging	1.00
R9788:Cntln	UTSW	4	85049856	missense	probably damaging	1.00
R9793:Cntln	UTSW	4	85067561	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GGTCATTGAGTTGGAAAATCGG -3'
(R):5'- TCACCTTGGTAGTGGCTGTC -3'

Sequencing Primer
(F):5'- TGAGTTGGAAAATCGGCTAAAATC -3'
(R):5'- ACATCTGTGGTGGCCATCTCAG -3'

Posted On

2022-06-15