Incidental Mutation 'R9471:Aff4'
ID 715480
Institutional Source Beutler Lab
Gene Symbol Aff4
Ensembl Gene ENSMUSG00000049470
Gene Name AF4/FMR2 family, member 4
Synonyms Laf4l, Alf4
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9471 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 53350833-53421830 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 53380646 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 337 (P337S)
Ref Sequence ENSEMBL: ENSMUSP00000051479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060945]
AlphaFold Q9ESC8
Predicted Effect probably benign
Transcript: ENSMUST00000060945
AA Change: P337S

PolyPhen 2 Score 0.132 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000051479
Gene: ENSMUSG00000049470
AA Change: P337S

DomainStartEndE-ValueType
Pfam:AF-4 2 1156 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152616
SMART Domains Protein: ENSMUSP00000118866
Gene: ENSMUSG00000049470

DomainStartEndE-ValueType
Pfam:AF-4 1 51 4e-15 PFAM
Pfam:AF-4 46 159 1.3e-30 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AF4 family of transcription factors involved in leukemia. It is a component of the positive transcription elongation factor b (P-TEFb) complex. A chromosomal translocation involving this gene and MLL gene on chromosome 11 is found in infant acute lymphoblastic leukemia with ins(5;11)(q31;q31q23). [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display embryonic and neonatal lethality with incomplete penetrance, abnormal respiration, and shrunken alveoli. Surviving males are infertile with azoospermia and arrest of spermatogenesis but, do not develop hematological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,567,057 K368E probably damaging Het
Adgrl2 T C 3: 148,852,729 T448A probably benign Het
Alg12 G A 15: 88,806,418 Q406* probably null Het
Anapc5 T C 5: 122,806,245 Y302C probably damaging Het
Apol7a A G 15: 77,389,480 S261P possibly damaging Het
Atad5 G T 11: 80,132,698 K1545N possibly damaging Het
Atp6v1f T A 6: 29,467,942 D42E probably benign Het
Bcl6 T A 16: 23,973,107 N166Y probably benign Het
Btbd7 C T 12: 102,793,886 R601Q probably damaging Het
Casp1 A G 9: 5,304,187 E287G probably benign Het
Cd300c A T 11: 114,956,390 V193E probably damaging Het
Cd300lg T A 11: 102,054,094 S377T probably benign Het
Ceacam13 T A 7: 18,019,087 *264R probably null Het
Clasrp G A 7: 19,585,247 R498* probably null Het
Clec4n T A 6: 123,244,546 N146K probably benign Het
Cntln T A 4: 85,049,782 V746E possibly damaging Het
Defa29 T C 8: 21,326,885 T31A possibly damaging Het
Egr4 A G 6: 85,512,713 S122P possibly damaging Het
Fam221a T G 6: 49,372,586 D28E probably damaging Het
Fanca G A 8: 123,274,158 T1161I possibly damaging Het
Frat2 A G 19: 41,847,674 S80P probably benign Het
Fuk T C 8: 110,883,409 E991G probably benign Het
Gm13089 T A 4: 143,697,179 T347S probably damaging Het
Gse1 C A 8: 120,575,106 S985R unknown Het
H2-M3 T A 17: 37,271,097 I148N probably damaging Het
Hs6st3 G T 14: 119,138,823 V137L probably damaging Het
Ighv1-42 T A 12: 114,937,307 M53L probably benign Het
Klhl24 C T 16: 20,122,985 T561I Het
Klhl26 C G 8: 70,452,153 G369A probably damaging Het
Klra5 C A 6: 129,906,723 W147L possibly damaging Het
Lrrd1 A T 5: 3,863,980 D750V Het
Mc5r A G 18: 68,339,056 D162G probably damaging Het
Mrc2 T A 11: 105,343,733 S1026R probably benign Het
Nf1 A G 11: 79,545,369 H1945R probably damaging Het
Nr4a2 A G 2: 57,112,102 M113T probably benign Het
Obox2 G A 7: 15,397,188 G73D probably damaging Het
Olfr330 A T 11: 58,529,529 C152* probably null Het
Olfr366 G A 2: 37,220,388 A300T probably damaging Het
Pappa2 C T 1: 158,814,459 M1342I probably benign Het
Pla2g6 A T 15: 79,317,839 L44Q probably damaging Het
Pnpla1 A T 17: 28,880,999 Q280L probably benign Het
Prdm1 C T 10: 44,450,178 G117S probably damaging Het
Prss36 A T 7: 127,946,433 F6I probably benign Het
Sat2 A G 11: 69,622,899 Y81C probably damaging Het
Sbspon T C 1: 15,892,453 D67G probably benign Het
Shank2 G A 7: 144,411,015 V787M possibly damaging Het
Stoml1 A T 9: 58,256,685 I96F probably damaging Het
Tet2 C T 3: 133,485,919 G918D probably damaging Het
Tgm4 A G 9: 123,040,379 I8V probably benign Het
Tmem156 C T 5: 65,080,188 R43K probably damaging Het
Trim44 T C 2: 102,400,306 S127G unknown Het
Ttn C T 2: 76,768,502 V19356M probably damaging Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Vmn2r67 A C 7: 85,150,515 probably null Het
Wdr90 C A 17: 25,861,041 V107L possibly damaging Het
Zfp316 T C 5: 143,255,406 D286G unknown Het
Zfp981 C A 4: 146,537,623 P335Q probably benign Het
Zscan18 T C 7: 12,774,416 T386A possibly damaging Het
Other mutations in Aff4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Aff4 APN 11 53411990 missense probably damaging 0.98
IGL01348:Aff4 APN 11 53402500 missense probably benign
IGL01446:Aff4 APN 11 53415469 missense probably damaging 0.99
IGL02151:Aff4 APN 11 53399806 missense probably benign
IGL02526:Aff4 APN 11 53406682 splice site probably benign
IGL02567:Aff4 APN 11 53372751 missense possibly damaging 0.64
IGL02633:Aff4 APN 11 53409371 splice site probably benign
IGL02707:Aff4 APN 11 53399740 missense probably benign
R0090:Aff4 UTSW 11 53392782 missense probably benign 0.01
R0128:Aff4 UTSW 11 53415466 missense probably damaging 0.99
R0243:Aff4 UTSW 11 53397858 missense possibly damaging 0.74
R0345:Aff4 UTSW 11 53372881 missense probably benign 0.00
R0347:Aff4 UTSW 11 53400088 missense probably benign 0.01
R0732:Aff4 UTSW 11 53375596 missense probably benign
R0737:Aff4 UTSW 11 53410953 nonsense probably null
R1464:Aff4 UTSW 11 53372524 missense probably damaging 0.97
R1464:Aff4 UTSW 11 53372524 missense probably damaging 0.97
R1500:Aff4 UTSW 11 53372378 missense probably benign 0.00
R1693:Aff4 UTSW 11 53396553 missense probably damaging 1.00
R1743:Aff4 UTSW 11 53368695 missense possibly damaging 0.65
R1961:Aff4 UTSW 11 53372999 missense probably damaging 1.00
R2048:Aff4 UTSW 11 53398385 missense probably benign 0.39
R2138:Aff4 UTSW 11 53372512 missense possibly damaging 0.94
R2155:Aff4 UTSW 11 53399619 missense probably damaging 1.00
R2379:Aff4 UTSW 11 53408478 splice site probably benign
R4156:Aff4 UTSW 11 53410899 intron probably benign
R5001:Aff4 UTSW 11 53404357 missense probably damaging 1.00
R5281:Aff4 UTSW 11 53372288 missense probably damaging 1.00
R5477:Aff4 UTSW 11 53408472 critical splice donor site probably null
R5677:Aff4 UTSW 11 53400275 missense possibly damaging 0.55
R5992:Aff4 UTSW 11 53373010 missense probably damaging 0.99
R6576:Aff4 UTSW 11 53400441 missense probably damaging 1.00
R6764:Aff4 UTSW 11 53399830 missense probably damaging 1.00
R6988:Aff4 UTSW 11 53398237 missense probably damaging 1.00
R7034:Aff4 UTSW 11 53408409 missense probably damaging 0.99
R7177:Aff4 UTSW 11 53406639 missense probably benign 0.10
R7426:Aff4 UTSW 11 53372875 missense probably damaging 1.00
R7755:Aff4 UTSW 11 53398379 missense probably damaging 0.97
R7848:Aff4 UTSW 11 53404512 missense probably benign 0.05
R7968:Aff4 UTSW 11 53409348 missense probably damaging 1.00
R8159:Aff4 UTSW 11 53411894 missense possibly damaging 0.71
R8218:Aff4 UTSW 11 53398257 missense probably damaging 0.98
R8241:Aff4 UTSW 11 53400171 missense probably benign 0.00
R8284:Aff4 UTSW 11 53404552 missense probably damaging 0.99
R8373:Aff4 UTSW 11 53400267 nonsense probably null
R8695:Aff4 UTSW 11 53368682 missense probably damaging 1.00
R8777:Aff4 UTSW 11 53399956 missense probably damaging 1.00
R8777-TAIL:Aff4 UTSW 11 53399956 missense probably damaging 1.00
R8780:Aff4 UTSW 11 53380617 missense probably damaging 1.00
R8798:Aff4 UTSW 11 53400508 critical splice donor site probably benign
R8838:Aff4 UTSW 11 53406638 missense possibly damaging 0.77
R8939:Aff4 UTSW 11 53372404 missense probably benign
R9146:Aff4 UTSW 11 53408136 missense probably benign 0.06
R9329:Aff4 UTSW 11 53397859 missense probably damaging 1.00
R9378:Aff4 UTSW 11 53372479 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCCACTGGCTCAGTATGCATAG -3'
(R):5'- TCTCAGTCAAAGATGCTCTCAATTC -3'

Sequencing Primer
(F):5'- CCACTGGCTCAGTATGCATAGTTTTG -3'
(R):5'- GTTTATCGTGTTTCCCAGC -3'
Posted On 2022-06-15