Mutagenetix > Incidental Mutation

Incidental Mutation 'R9471:Aff4'

715480

Institutional Source

Beutler Lab

Gene Symbol

Aff4

Ensembl Gene

ENSMUSG00000049470

Gene Name

AF4/FMR2 family, member 4

Synonyms

Laf4l, Alf4

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9471 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

53350833-53421830 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 53380646 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 337 (P337S)

Ref Sequence

ENSEMBL: ENSMUSP00000051479 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060945]

AlphaFold

Q9ESC8

Predicted Effect

probably benign
Transcript: ENSMUST00000060945
AA Change: P337S

PolyPhen 2 Score 0.132 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000051479
Gene: ENSMUSG00000049470
AA Change: P337S

Domain	Start	End	E-Value	Type
Pfam:AF-4	2	1156	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000152616

SMART Domains

Protein: ENSMUSP00000118866
Gene: ENSMUSG00000049470

Domain	Start	End	E-Value	Type
Pfam:AF-4	1	51	4e-15	PFAM
Pfam:AF-4	46	159	1.3e-30	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AF4 family of transcription factors involved in leukemia. It is a component of the positive transcription elongation factor b (P-TEFb) complex. A chromosomal translocation involving this gene and MLL gene on chromosome 11 is found in infant acute lymphoblastic leukemia with ins(5;11)(q31;q31q23). [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display embryonic and neonatal lethality with incomplete penetrance, abnormal respiration, and shrunken alveoli. Surviving males are infertile with azoospermia and arrest of spermatogenesis but, do not develop hematological abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actl6b	A	G	5: 137,567,057	K368E	probably damaging	Het
Adgrl2	T	C	3: 148,852,729	T448A	probably benign	Het
Alg12	G	A	15: 88,806,418	Q406*	probably null	Het
Anapc5	T	C	5: 122,806,245	Y302C	probably damaging	Het
Apol7a	A	G	15: 77,389,480	S261P	possibly damaging	Het
Atad5	G	T	11: 80,132,698	K1545N	possibly damaging	Het
Atp6v1f	T	A	6: 29,467,942	D42E	probably benign	Het
Bcl6	T	A	16: 23,973,107	N166Y	probably benign	Het
Btbd7	C	T	12: 102,793,886	R601Q	probably damaging	Het
Casp1	A	G	9: 5,304,187	E287G	probably benign	Het
Cd300c	A	T	11: 114,956,390	V193E	probably damaging	Het
Cd300lg	T	A	11: 102,054,094	S377T	probably benign	Het
Ceacam13	T	A	7: 18,019,087	*264R	probably null	Het
Clasrp	G	A	7: 19,585,247	R498*	probably null	Het
Clec4n	T	A	6: 123,244,546	N146K	probably benign	Het
Cntln	T	A	4: 85,049,782	V746E	possibly damaging	Het
Defa29	T	C	8: 21,326,885	T31A	possibly damaging	Het
Egr4	A	G	6: 85,512,713	S122P	possibly damaging	Het
Fam221a	T	G	6: 49,372,586	D28E	probably damaging	Het
Fanca	G	A	8: 123,274,158	T1161I	possibly damaging	Het
Frat2	A	G	19: 41,847,674	S80P	probably benign	Het
Fuk	T	C	8: 110,883,409	E991G	probably benign	Het
Gm13089	T	A	4: 143,697,179	T347S	probably damaging	Het
Gse1	C	A	8: 120,575,106	S985R	unknown	Het
H2-M3	T	A	17: 37,271,097	I148N	probably damaging	Het
Hs6st3	G	T	14: 119,138,823	V137L	probably damaging	Het
Ighv1-42	T	A	12: 114,937,307	M53L	probably benign	Het
Klhl24	C	T	16: 20,122,985	T561I		Het
Klhl26	C	G	8: 70,452,153	G369A	probably damaging	Het
Klra5	C	A	6: 129,906,723	W147L	possibly damaging	Het
Lrrd1	A	T	5: 3,863,980	D750V		Het
Mc5r	A	G	18: 68,339,056	D162G	probably damaging	Het
Mrc2	T	A	11: 105,343,733	S1026R	probably benign	Het
Nf1	A	G	11: 79,545,369	H1945R	probably damaging	Het
Nr4a2	A	G	2: 57,112,102	M113T	probably benign	Het
Obox2	G	A	7: 15,397,188	G73D	probably damaging	Het
Olfr330	A	T	11: 58,529,529	C152*	probably null	Het
Olfr366	G	A	2: 37,220,388	A300T	probably damaging	Het
Pappa2	C	T	1: 158,814,459	M1342I	probably benign	Het
Pla2g6	A	T	15: 79,317,839	L44Q	probably damaging	Het
Pnpla1	A	T	17: 28,880,999	Q280L	probably benign	Het
Prdm1	C	T	10: 44,450,178	G117S	probably damaging	Het
Prss36	A	T	7: 127,946,433	F6I	probably benign	Het
Sat2	A	G	11: 69,622,899	Y81C	probably damaging	Het
Sbspon	T	C	1: 15,892,453	D67G	probably benign	Het
Shank2	G	A	7: 144,411,015	V787M	possibly damaging	Het
Stoml1	A	T	9: 58,256,685	I96F	probably damaging	Het
Tet2	C	T	3: 133,485,919	G918D	probably damaging	Het
Tgm4	A	G	9: 123,040,379	I8V	probably benign	Het
Tmem156	C	T	5: 65,080,188	R43K	probably damaging	Het
Trim44	T	C	2: 102,400,306	S127G	unknown	Het
Ttn	C	T	2: 76,768,502	V19356M	probably damaging	Het
Tyw1	G	A	5: 130,269,224	R202Q	probably damaging	Het
Vmn2r67	A	C	7: 85,150,515		probably null	Het
Wdr90	C	A	17: 25,861,041	V107L	possibly damaging	Het
Zfp316	T	C	5: 143,255,406	D286G	unknown	Het
Zfp981	C	A	4: 146,537,623	P335Q	probably benign	Het
Zscan18	T	C	7: 12,774,416	T386A	possibly damaging	Het

Other mutations in Aff4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00793:Aff4	APN	11	53411990	missense	probably damaging	0.98
IGL01348:Aff4	APN	11	53402500	missense	probably benign
IGL01446:Aff4	APN	11	53415469	missense	probably damaging	0.99
IGL02151:Aff4	APN	11	53399806	missense	probably benign
IGL02526:Aff4	APN	11	53406682	splice site	probably benign
IGL02567:Aff4	APN	11	53372751	missense	possibly damaging	0.64
IGL02633:Aff4	APN	11	53409371	splice site	probably benign
IGL02707:Aff4	APN	11	53399740	missense	probably benign
R0090:Aff4	UTSW	11	53392782	missense	probably benign	0.01
R0128:Aff4	UTSW	11	53415466	missense	probably damaging	0.99
R0243:Aff4	UTSW	11	53397858	missense	possibly damaging	0.74
R0345:Aff4	UTSW	11	53372881	missense	probably benign	0.00
R0347:Aff4	UTSW	11	53400088	missense	probably benign	0.01
R0732:Aff4	UTSW	11	53375596	missense	probably benign
R0737:Aff4	UTSW	11	53410953	nonsense	probably null
R1464:Aff4	UTSW	11	53372524	missense	probably damaging	0.97
R1464:Aff4	UTSW	11	53372524	missense	probably damaging	0.97
R1500:Aff4	UTSW	11	53372378	missense	probably benign	0.00
R1693:Aff4	UTSW	11	53396553	missense	probably damaging	1.00
R1743:Aff4	UTSW	11	53368695	missense	possibly damaging	0.65
R1961:Aff4	UTSW	11	53372999	missense	probably damaging	1.00
R2048:Aff4	UTSW	11	53398385	missense	probably benign	0.39
R2138:Aff4	UTSW	11	53372512	missense	possibly damaging	0.94
R2155:Aff4	UTSW	11	53399619	missense	probably damaging	1.00
R2379:Aff4	UTSW	11	53408478	splice site	probably benign
R4156:Aff4	UTSW	11	53410899	intron	probably benign
R5001:Aff4	UTSW	11	53404357	missense	probably damaging	1.00
R5281:Aff4	UTSW	11	53372288	missense	probably damaging	1.00
R5477:Aff4	UTSW	11	53408472	critical splice donor site	probably null
R5677:Aff4	UTSW	11	53400275	missense	possibly damaging	0.55
R5992:Aff4	UTSW	11	53373010	missense	probably damaging	0.99
R6576:Aff4	UTSW	11	53400441	missense	probably damaging	1.00
R6764:Aff4	UTSW	11	53399830	missense	probably damaging	1.00
R6988:Aff4	UTSW	11	53398237	missense	probably damaging	1.00
R7034:Aff4	UTSW	11	53408409	missense	probably damaging	0.99
R7177:Aff4	UTSW	11	53406639	missense	probably benign	0.10
R7426:Aff4	UTSW	11	53372875	missense	probably damaging	1.00
R7755:Aff4	UTSW	11	53398379	missense	probably damaging	0.97
R7848:Aff4	UTSW	11	53404512	missense	probably benign	0.05
R7968:Aff4	UTSW	11	53409348	missense	probably damaging	1.00
R8159:Aff4	UTSW	11	53411894	missense	possibly damaging	0.71
R8218:Aff4	UTSW	11	53398257	missense	probably damaging	0.98
R8241:Aff4	UTSW	11	53400171	missense	probably benign	0.00
R8284:Aff4	UTSW	11	53404552	missense	probably damaging	0.99
R8373:Aff4	UTSW	11	53400267	nonsense	probably null
R8695:Aff4	UTSW	11	53368682	missense	probably damaging	1.00
R8777:Aff4	UTSW	11	53399956	missense	probably damaging	1.00
R8777-TAIL:Aff4	UTSW	11	53399956	missense	probably damaging	1.00
R8780:Aff4	UTSW	11	53380617	missense	probably damaging	1.00
R8798:Aff4	UTSW	11	53400508	critical splice donor site	probably benign
R8838:Aff4	UTSW	11	53406638	missense	possibly damaging	0.77
R8939:Aff4	UTSW	11	53372404	missense	probably benign
R9146:Aff4	UTSW	11	53408136	missense	probably benign	0.06
R9329:Aff4	UTSW	11	53397859	missense	probably damaging	1.00
R9378:Aff4	UTSW	11	53372479	missense	probably damaging	0.98
R9779:Aff4	UTSW	11	53372907	nonsense	probably null
R9796:Aff4	UTSW	11	53411997	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TCCACTGGCTCAGTATGCATAG -3'
(R):5'- TCTCAGTCAAAGATGCTCTCAATTC -3'

Sequencing Primer
(F):5'- CCACTGGCTCAGTATGCATAGTTTTG -3'
(R):5'- GTTTATCGTGTTTCCCAGC -3'

Posted On

2022-06-15