Incidental Mutation 'R9471:Cd300c'
ID 715487
Institutional Source Beutler Lab
Gene Symbol Cd300c
Ensembl Gene ENSMUSG00000058728
Gene Name CD300C molecule
Synonyms Clm6
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9471 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 114956116-114969157 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 114956390 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 193 (V193E)
Ref Sequence ENSEMBL: ENSMUSP00000052647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061637] [ENSMUST00000092466]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000061637
AA Change: V193E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052647
Gene: ENSMUSG00000058728
AA Change: V193E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IG 28 133 2.48e-8 SMART
low complexity region 174 187 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092466
AA Change: V193E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000090123
Gene: ENSMUSG00000058728
AA Change: V193E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IG 28 133 2.48e-8 SMART
low complexity region 174 187 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,567,057 K368E probably damaging Het
Adgrl2 T C 3: 148,852,729 T448A probably benign Het
Aff4 C T 11: 53,380,646 P337S probably benign Het
Alg12 G A 15: 88,806,418 Q406* probably null Het
Anapc5 T C 5: 122,806,245 Y302C probably damaging Het
Apol7a A G 15: 77,389,480 S261P possibly damaging Het
Atad5 G T 11: 80,132,698 K1545N possibly damaging Het
Atp6v1f T A 6: 29,467,942 D42E probably benign Het
Bcl6 T A 16: 23,973,107 N166Y probably benign Het
Btbd7 C T 12: 102,793,886 R601Q probably damaging Het
Casp1 A G 9: 5,304,187 E287G probably benign Het
Cd300lg T A 11: 102,054,094 S377T probably benign Het
Ceacam13 T A 7: 18,019,087 *264R probably null Het
Clasrp G A 7: 19,585,247 R498* probably null Het
Clec4n T A 6: 123,244,546 N146K probably benign Het
Cntln T A 4: 85,049,782 V746E possibly damaging Het
Defa29 T C 8: 21,326,885 T31A possibly damaging Het
Egr4 A G 6: 85,512,713 S122P possibly damaging Het
Fam221a T G 6: 49,372,586 D28E probably damaging Het
Fanca G A 8: 123,274,158 T1161I possibly damaging Het
Frat2 A G 19: 41,847,674 S80P probably benign Het
Fuk T C 8: 110,883,409 E991G probably benign Het
Gm13089 T A 4: 143,697,179 T347S probably damaging Het
Gse1 C A 8: 120,575,106 S985R unknown Het
H2-M3 T A 17: 37,271,097 I148N probably damaging Het
Hs6st3 G T 14: 119,138,823 V137L probably damaging Het
Ighv1-42 T A 12: 114,937,307 M53L probably benign Het
Klhl24 C T 16: 20,122,985 T561I Het
Klhl26 C G 8: 70,452,153 G369A probably damaging Het
Klra5 C A 6: 129,906,723 W147L possibly damaging Het
Lrrd1 A T 5: 3,863,980 D750V Het
Mc5r A G 18: 68,339,056 D162G probably damaging Het
Mrc2 T A 11: 105,343,733 S1026R probably benign Het
Nf1 A G 11: 79,545,369 H1945R probably damaging Het
Nr4a2 A G 2: 57,112,102 M113T probably benign Het
Obox2 G A 7: 15,397,188 G73D probably damaging Het
Olfr330 A T 11: 58,529,529 C152* probably null Het
Olfr366 G A 2: 37,220,388 A300T probably damaging Het
Pappa2 C T 1: 158,814,459 M1342I probably benign Het
Pla2g6 A T 15: 79,317,839 L44Q probably damaging Het
Pnpla1 A T 17: 28,880,999 Q280L probably benign Het
Prdm1 C T 10: 44,450,178 G117S probably damaging Het
Prss36 A T 7: 127,946,433 F6I probably benign Het
Sat2 A G 11: 69,622,899 Y81C probably damaging Het
Sbspon T C 1: 15,892,453 D67G probably benign Het
Shank2 G A 7: 144,411,015 V787M possibly damaging Het
Stoml1 A T 9: 58,256,685 I96F probably damaging Het
Tet2 C T 3: 133,485,919 G918D probably damaging Het
Tgm4 A G 9: 123,040,379 I8V probably benign Het
Tmem156 C T 5: 65,080,188 R43K probably damaging Het
Trim44 T C 2: 102,400,306 S127G unknown Het
Ttn C T 2: 76,768,502 V19356M probably damaging Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Vmn2r67 A C 7: 85,150,515 probably null Het
Wdr90 C A 17: 25,861,041 V107L possibly damaging Het
Zfp316 T C 5: 143,255,406 D286G unknown Het
Zfp981 C A 4: 146,537,623 P335Q probably benign Het
Zscan18 T C 7: 12,774,416 T386A possibly damaging Het
Other mutations in Cd300c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Cd300c APN 11 114959790 missense probably benign
IGL01067:Cd300c APN 11 114960427 unclassified probably benign
R0325:Cd300c UTSW 11 114959585 nonsense probably null
R1471:Cd300c UTSW 11 114959788 missense probably benign 0.09
R2880:Cd300c UTSW 11 114959790 missense probably benign
R3830:Cd300c UTSW 11 114959627 missense probably benign 0.00
R6369:Cd300c UTSW 11 114957555 missense probably damaging 1.00
R7240:Cd300c UTSW 11 114959783 missense possibly damaging 0.93
R9087:Cd300c UTSW 11 114959765 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCTTCTCAGCCACTAGAG -3'
(R):5'- TTAGTCTCAAGAGAGCAGGTCAAG -3'

Sequencing Primer
(F):5'- TTCTCAGCCACTAGAGGAGCTG -3'
(R):5'- TATCACACTGGTCATTCAGGCAG -3'
Posted On 2022-06-15