Incidental Mutation 'R9472:Rslcan18'
ID 715538
Institutional Source Beutler Lab
Gene Symbol Rslcan18
Ensembl Gene ENSMUSG00000074824
Gene Name regulator of sex-limitation candidate 18
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock # R9472 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 67096613-67116263 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 67112232 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 34 (K34E)
Ref Sequence ENSEMBL: ENSMUSP00000089111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091526] [ENSMUST00000186303]
AlphaFold Q7M6X5
Predicted Effect probably benign
Transcript: ENSMUST00000091526
AA Change: K34E

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000089111
Gene: ENSMUSG00000074824
AA Change: K34E

DomainStartEndE-ValueType
KRAB 96 156 5.31e-28 SMART
ZnF_C2H2 171 193 4.24e-4 SMART
ZnF_C2H2 199 221 1.56e-2 SMART
ZnF_C2H2 227 249 1.82e-3 SMART
ZnF_C2H2 255 277 1.82e-3 SMART
ZnF_C2H2 283 305 3.26e-5 SMART
ZnF_C2H2 311 333 1.82e-3 SMART
ZnF_C2H2 339 361 1.26e-2 SMART
ZnF_C2H2 367 389 2.12e-4 SMART
ZnF_C2H2 395 417 4.87e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186303
SMART Domains Protein: ENSMUSP00000140296
Gene: ENSMUSG00000100235

DomainStartEndE-ValueType
KRAB 1 32 9.7e-3 SMART
ZnF_C2H2 47 69 1.8e-6 SMART
ZnF_C2H2 75 97 6.7e-5 SMART
ZnF_C2H2 103 125 7.6e-6 SMART
ZnF_C2H2 131 153 7.6e-6 SMART
ZnF_C2H2 159 181 1.4e-7 SMART
ZnF_C2H2 187 209 7.6e-6 SMART
ZnF_C2H2 215 237 5.5e-5 SMART
ZnF_C2H2 243 265 8.9e-7 SMART
ZnF_C2H2 271 293 2e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 T G 8: 24,637,232 K449N probably benign Het
Adam39 G A 8: 40,826,314 V581I possibly damaging Het
Agrn A G 4: 156,170,384 F1625S Het
Aox3 G T 1: 58,176,510 V1034L possibly damaging Het
Baz2a T G 10: 128,112,755 S302A probably benign Het
Capn9 T C 8: 124,598,795 probably null Het
Ccdc153 A T 9: 44,243,626 Q104L possibly damaging Het
Cdh1 A T 8: 106,653,616 N168I probably damaging Het
Crisp3 A T 17: 40,228,785 probably null Het
Ctsb T C 14: 63,141,737 V266A probably damaging Het
Cyp2c39 G T 19: 39,513,599 R144L probably damaging Het
Elmo1 C T 13: 20,286,727 A263V probably benign Het
Enkur T C 2: 21,196,779 R32G possibly damaging Het
Fam126b A G 1: 58,535,482 V300A possibly damaging Het
Fsip2 T A 2: 82,986,941 N4339K possibly damaging Het
Gsn T G 2: 35,292,729 M268R probably damaging Het
Herc2 T A 7: 56,164,095 W2659R probably damaging Het
Ino80e A G 7: 126,861,955 V40A unknown Het
Ints2 T C 11: 86,242,998 T409A Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kat2a A G 11: 100,705,371 V787A probably benign Het
Klhl32 A G 4: 24,629,273 V465A probably benign Het
Kmt2a C A 9: 44,822,156 R2288L unknown Het
Megf6 G A 4: 154,249,453 G213S probably damaging Het
Mt2 T A 8: 94,173,371 C44S probably damaging Het
Nfe2l1 A G 11: 96,819,333 V690A probably damaging Het
Obscn T C 11: 59,003,669 H6670R Het
Olfr1216 A C 2: 89,013,173 I297S possibly damaging Het
Orc4 T C 2: 48,905,551 T388A probably benign Het
Pcdhb17 C A 18: 37,485,866 N236K probably damaging Het
Phlpp1 T C 1: 106,380,349 S1119P probably damaging Het
Plppr3 T C 10: 79,866,877 D184G probably damaging Het
Rassf6 A T 5: 90,617,713 Y46* probably null Het
Rmdn2 T A 17: 79,681,667 I405N possibly damaging Het
Rsbn1l A C 5: 20,908,121 S468A probably damaging Het
Runx3 A G 4: 135,171,130 D204G probably damaging Het
Sbf2 A G 7: 110,371,591 I866T possibly damaging Het
Sgtb A C 13: 104,111,173 E28D probably benign Het
Slc38a8 T A 8: 119,501,149 K14M probably damaging Het
Spast T C 17: 74,374,148 V478A probably damaging Het
Stxbp5 T C 10: 9,843,357 T147A probably damaging Het
Tmem208 T C 8: 105,328,395 F79S probably damaging Het
Tmprss7 T C 16: 45,680,689 I250V probably benign Het
Usp24 A G 4: 106,403,931 T1628A probably benign Het
Vmn2r14 G T 5: 109,220,096 N343K probably benign Het
Xrcc6 T A 15: 82,029,127 Y320* probably null Het
Zbtb10 A C 3: 9,278,295 T627P probably benign Het
Zfp532 A T 18: 65,623,553 K186* probably null Het
Other mutations in Rslcan18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01520:Rslcan18 APN 13 67102108 missense probably benign 0.01
IGL01760:Rslcan18 APN 13 67113951 missense probably benign 0.04
R0003:Rslcan18 UTSW 13 67098469 missense probably benign 0.01
R0333:Rslcan18 UTSW 13 67098622 missense probably damaging 0.99
R0505:Rslcan18 UTSW 13 67102119 missense probably benign 0.31
R0525:Rslcan18 UTSW 13 67112258 missense probably benign 0.03
R0898:Rslcan18 UTSW 13 67098816 missense probably benign 0.02
R1449:Rslcan18 UTSW 13 67102100 missense possibly damaging 0.65
R1511:Rslcan18 UTSW 13 67098952 missense possibly damaging 0.94
R1575:Rslcan18 UTSW 13 67108057 intron probably benign
R1973:Rslcan18 UTSW 13 67108023 intron probably benign
R3109:Rslcan18 UTSW 13 67098607 missense possibly damaging 0.53
R4707:Rslcan18 UTSW 13 67098526 missense probably damaging 1.00
R5277:Rslcan18 UTSW 13 67098434 missense probably benign 0.03
R8887:Rslcan18 UTSW 13 67098729 missense probably damaging 1.00
R9475:Rslcan18 UTSW 13 67102064 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAGCTTTAAAATCACGGCG -3'
(R):5'- CCACCATGTCAGAGTTCCAAG -3'

Sequencing Primer
(F):5'- AATCACGGCGTCTTAGCAG -3'
(R):5'- CAGAGTTCCAAGACCAGTTTTGAGC -3'
Posted On 2022-06-15