Incidental Mutation 'R9474:Rp1'
ID 715602
Institutional Source Beutler Lab
Gene Symbol Rp1
Ensembl Gene ENSMUSG00000025900
Gene Name retinitis pigmentosa 1 (human)
Synonyms Dcdc3, mG145, Orp1, oxygen-regulated protein 1, Rp1h
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R9474 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 3999557-4409241 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 4092615 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000208660]
AlphaFold P56716
Predicted Effect probably null
Transcript: ENSMUST00000208660
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the doublecortin family. The protein encoded by this gene contains two doublecortin domains, which bind microtubules and regulate microtubule polymerization. The encoded protein is a photoreceptor microtubule-associated protein and is required for correct stacking of outer segment disc. This protein and the RP1L1 protein, another retinal-specific protein, play essential and synergistic roles in affecting photosensitivity and outer segment morphogenesis of rod photoreceptors. Because of its response to in vivo retinal oxygen levels, this protein was initially named ORP1 (oxygen-regulated protein-1). This protein was subsequently designated RP1 (retinitis pigmentosa 1) when it was found that mutations in this gene cause autosomal dominant retinitis pigmentosa. Mutations in this gene also cause autosomal recessive retinitis pigmentosa. Two transcript variants encoding distinct isoforms are resulted from alternative promoters and alternative splicing. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene experience progressive degeneration in photoreceptors but are otherwise phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik C A 10: 79,067,731 K250N probably damaging Het
9530077C05Rik T C 9: 22,431,719 M303T probably damaging Het
Adam5 A T 8: 24,747,524 D623E possibly damaging Het
Akt3 T C 1: 177,025,386 Y473C probably damaging Het
Ankib1 A G 5: 3,755,617 Y217H probably damaging Het
Clca4b T A 3: 144,911,166 T908S probably benign Het
Clec7a G A 6: 129,463,163 Q160* probably null Het
Cntnap4 T A 8: 112,733,471 I152N probably damaging Het
Ctdspl C T 9: 119,037,377 A179V probably damaging Het
Ddx43 T C 9: 78,406,386 S200P probably damaging Het
Dip2c A G 13: 9,494,927 D84G unknown Het
Dmbt1 G A 7: 131,074,257 R625H unknown Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
E2f7 C T 10: 110,767,189 T355I probably damaging Het
E2f7 C A 10: 110,779,057 L541M probably damaging Het
Elovl5 T A 9: 77,982,725 S273T possibly damaging Het
Emc1 T A 4: 139,366,394 L605Q probably damaging Het
Fras1 T A 5: 96,739,265 D2635E probably benign Het
Gabrb1 G A 5: 72,108,347 G195E probably damaging Het
Galm A G 17: 80,150,132 D199G possibly damaging Het
Galntl6 T G 8: 57,777,325 S20R probably damaging Het
Gm21671 A T 5: 25,953,138 I72N probably damaging Het
Grb14 T G 2: 64,938,400 Y189S probably damaging Het
Hk2 T A 6: 82,728,914 I803F probably damaging Het
Hmcn1 G A 1: 150,630,720 R3779W probably damaging Het
Hmgcr A C 13: 96,659,895 M260R probably damaging Het
Hsbp1l1 T A 18: 80,233,424 K68N possibly damaging Het
Inhba A C 13: 16,017,678 E128A probably benign Het
Itpr3 G A 17: 27,118,677 probably benign Het
Klhl3 G A 13: 58,019,459 P364S probably damaging Het
Lhpp T C 7: 132,641,583 L176P probably damaging Het
Lrp1b C A 2: 40,601,587 A223S probably damaging Het
Lrp3 A G 7: 35,204,064 F286L probably damaging Het
Lrrc7 T C 3: 158,135,391 T1337A probably benign Het
Magi2 A G 5: 20,195,021 D17G probably benign Het
Map3k21 T C 8: 125,924,164 S302P probably damaging Het
Mbtd1 A G 11: 93,925,685 D386G probably benign Het
Mfsd2b A T 12: 4,866,820 D306E possibly damaging Het
Muc20 T C 16: 32,794,083 E308G probably damaging Het
Myh13 G A 11: 67,364,886 S34N Het
Nebl C A 2: 17,369,610 G894* probably null Het
Nelfa A G 5: 33,898,751 Y523H probably damaging Het
Ninj1 A G 13: 49,187,600 D13G probably benign Het
Ninl A T 2: 150,940,806 S170T probably benign Het
Nlrp4c G A 7: 6,065,627 V176M possibly damaging Het
Nobox G A 6: 43,307,181 R144C probably damaging Het
Oas1a G A 5: 120,899,254 L237F probably damaging Het
Olfr1099 A G 2: 86,959,413 M15T probably benign Het
Olfr1153 T C 2: 87,896,349 M50T probably benign Het
Olfr1254 A C 2: 89,789,162 Y63* probably null Het
Olfr1348 A G 7: 6,502,151 L25P probably benign Het
Olfr1356 T C 10: 78,847,057 N286S probably damaging Het
Olfr625-ps1 A T 7: 103,683,270 Y184F probably damaging Het
Orai1 A G 5: 123,029,238 N158S probably damaging Het
Pa2g4 C A 10: 128,563,098 V121L probably benign Het
Pclo T C 5: 14,521,236 S212P possibly damaging Het
Plce1 G A 19: 38,777,893 E2121K possibly damaging Het
Plg A G 17: 12,403,137 Y448C probably damaging Het
Plppr4 A T 3: 117,323,217 N330K probably damaging Het
Pou2f2 A G 7: 25,094,822 L373S probably benign Het
Rnpep A G 1: 135,283,603 F136L probably benign Het
Shank1 G A 7: 44,312,918 S71N unknown Het
Slc5a4a GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC 10: 76,150,404 probably benign Het
Slc5a5 T C 8: 70,884,952 D574G probably benign Het
Slc7a15 T A 12: 8,538,794 N251I probably damaging Het
Susd4 T C 1: 182,892,100 S427P probably benign Het
Tarbp1 T A 8: 126,429,040 T1320S probably benign Het
Tbpl2 C T 2: 24,094,638 V166I probably benign Het
Thbs1 T C 2: 118,120,037 probably null Het
Tnfsf13b A G 8: 10,031,648 Y270C probably damaging Het
Vps11 G T 9: 44,348,993 C857* probably null Het
Vsig10 G A 5: 117,325,039 R110H probably benign Het
Wee2 T A 6: 40,455,110 Y204* probably null Het
Zfpm2 T A 15: 41,103,471 S1117R probably damaging Het
Zscan5b A G 7: 6,231,473 N166S probably benign Het
Other mutations in Rp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Rp1 APN 1 4346746 missense probably damaging 0.98
IGL00593:Rp1 APN 1 4345403 missense possibly damaging 0.70
IGL00956:Rp1 APN 1 4352212 missense probably damaging 1.00
IGL01070:Rp1 APN 1 4345238 missense probably damaging 1.00
IGL01531:Rp1 APN 1 4348945 missense probably benign 0.00
IGL01668:Rp1 APN 1 4345718 missense probably damaging 1.00
IGL01907:Rp1 APN 1 4348507 missense possibly damaging 0.56
IGL02055:Rp1 APN 1 4352522 missense probably damaging 1.00
IGL02071:Rp1 APN 1 4345310 missense possibly damaging 0.46
IGL02128:Rp1 APN 1 4347385 missense probably damaging 0.99
IGL02244:Rp1 APN 1 4348780 missense probably benign 0.00
IGL02381:Rp1 APN 1 4352390 missense probably benign 0.01
IGL02499:Rp1 APN 1 4349048 missense probably benign 0.17
IGL02619:Rp1 APN 1 4348450 missense possibly damaging 0.73
IGL02832:Rp1 APN 1 4349713 missense probably benign 0.03
IGL02861:Rp1 APN 1 4346152 nonsense probably null
IGL03288:Rp1 APN 1 4349524 missense possibly damaging 0.88
IGL03290:Rp1 APN 1 4350041 missense probably damaging 1.00
IGL03303:Rp1 APN 1 4344817 missense probably damaging 1.00
R0041:Rp1 UTSW 1 4344628 missense probably benign 0.36
R0111:Rp1 UTSW 1 4344760 missense probably damaging 1.00
R0363:Rp1 UTSW 1 4347718 missense probably damaging 1.00
R0440:Rp1 UTSW 1 4345640 missense probably damaging 1.00
R0442:Rp1 UTSW 1 4346747 missense probably benign 0.09
R0528:Rp1 UTSW 1 4344865 missense possibly damaging 0.82
R0586:Rp1 UTSW 1 4347837 missense possibly damaging 0.76
R0639:Rp1 UTSW 1 4346498 missense probably benign 0.00
R0856:Rp1 UTSW 1 4344655 missense probably benign 0.05
R0908:Rp1 UTSW 1 4344655 missense probably benign 0.05
R0968:Rp1 UTSW 1 4345352 missense probably benign 0.00
R1099:Rp1 UTSW 1 4352290 missense possibly damaging 0.45
R1242:Rp1 UTSW 1 4344962 missense probably benign 0.03
R1301:Rp1 UTSW 1 4345936 missense possibly damaging 0.56
R1327:Rp1 UTSW 1 4347970 missense probably benign 0.01
R1403:Rp1 UTSW 1 4346297 missense possibly damaging 0.73
R1403:Rp1 UTSW 1 4346297 missense possibly damaging 0.73
R1406:Rp1 UTSW 1 4351921 missense possibly damaging 0.88
R1406:Rp1 UTSW 1 4351921 missense possibly damaging 0.88
R1440:Rp1 UTSW 1 4347396 missense probably damaging 1.00
R1509:Rp1 UTSW 1 4347694 missense probably damaging 0.98
R1509:Rp1 UTSW 1 4348537 missense probably benign 0.20
R1538:Rp1 UTSW 1 4345676 missense probably damaging 1.00
R1609:Rp1 UTSW 1 4349201 missense probably damaging 1.00
R1666:Rp1 UTSW 1 4349863 missense probably damaging 1.00
R1703:Rp1 UTSW 1 4345169 missense probably damaging 1.00
R1782:Rp1 UTSW 1 4349089 missense probably benign 0.00
R1799:Rp1 UTSW 1 4348832 missense possibly damaging 0.94
R1848:Rp1 UTSW 1 4347232 missense possibly damaging 0.76
R1908:Rp1 UTSW 1 4348720 missense probably damaging 0.99
R1919:Rp1 UTSW 1 4352671 missense probably damaging 0.99
R2087:Rp1 UTSW 1 4348352 missense probably damaging 1.00
R2211:Rp1 UTSW 1 4348139 missense probably damaging 0.96
R2278:Rp1 UTSW 1 4348027 missense possibly damaging 0.51
R2287:Rp1 UTSW 1 4345959 nonsense probably null
R2316:Rp1 UTSW 1 4345640 missense probably damaging 1.00
R2346:Rp1 UTSW 1 4348013 missense probably damaging 1.00
R2878:Rp1 UTSW 1 4348139 missense probably damaging 1.00
R3023:Rp1 UTSW 1 4352675 missense probably damaging 1.00
R3025:Rp1 UTSW 1 4352675 missense probably damaging 1.00
R3716:Rp1 UTSW 1 4349765 missense probably benign 0.38
R3814:Rp1 UTSW 1 4349708 missense probably benign
R3929:Rp1 UTSW 1 4352645 missense probably damaging 1.00
R4064:Rp1 UTSW 1 4345400 missense probably benign 0.08
R4426:Rp1 UTSW 1 4347924 missense probably benign 0.13
R4557:Rp1 UTSW 1 4344663 missense possibly damaging 0.61
R4764:Rp1 UTSW 1 4345878 missense probably damaging 0.96
R4845:Rp1 UTSW 1 4349228 missense probably benign 0.02
R4850:Rp1 UTSW 1 4348675 missense probably damaging 1.00
R4857:Rp1 UTSW 1 4352316 missense probably damaging 0.99
R4857:Rp1 UTSW 1 4352317 missense probably damaging 1.00
R5159:Rp1 UTSW 1 4346203 missense possibly damaging 0.73
R5226:Rp1 UTSW 1 4348033 missense probably benign 0.01
R5327:Rp1 UTSW 1 4349360 splice site probably null
R5352:Rp1 UTSW 1 4347098 missense probably benign 0.00
R5504:Rp1 UTSW 1 4349890 missense probably damaging 1.00
R5527:Rp1 UTSW 1 4346393 missense possibly damaging 0.75
R5529:Rp1 UTSW 1 4345832 missense probably benign 0.42
R5569:Rp1 UTSW 1 4345237 missense probably damaging 1.00
R5622:Rp1 UTSW 1 4347837 missense possibly damaging 0.76
R5970:Rp1 UTSW 1 4348462 missense probably benign 0.05
R5992:Rp1 UTSW 1 4148703 missense unknown
R6004:Rp1 UTSW 1 4197585 missense unknown
R6018:Rp1 UTSW 1 4352836 missense possibly damaging 0.83
R6074:Rp1 UTSW 1 4345379 missense probably benign 0.02
R6127:Rp1 UTSW 1 4349311 missense possibly damaging 0.80
R6187:Rp1 UTSW 1 4349869 missense probably damaging 1.00
R6301:Rp1 UTSW 1 4347254 missense probably benign 0.04
R6317:Rp1 UTSW 1 4041989 missense unknown
R6405:Rp1 UTSW 1 4345771 missense probably damaging 1.00
R6445:Rp1 UTSW 1 4226617 missense unknown
R6466:Rp1 UTSW 1 4347886 missense probably benign 0.01
R6501:Rp1 UTSW 1 4311280 intron probably benign
R6547:Rp1 UTSW 1 4170305 missense unknown
R6604:Rp1 UTSW 1 4019128 missense unknown
R6700:Rp1 UTSW 1 4349896 missense probably damaging 1.00
R6706:Rp1 UTSW 1 4142664 missense unknown
R6831:Rp1 UTSW 1 4349864 splice site probably null
R6918:Rp1 UTSW 1 3999608 missense unknown
R6973:Rp1 UTSW 1 4351994 nonsense probably null
R6981:Rp1 UTSW 1 4345655 missense probably benign 0.06
R7009:Rp1 UTSW 1 4042068 missense unknown
R7078:Rp1 UTSW 1 4206791 missense unknown
R7112:Rp1 UTSW 1 4349018 missense probably benign 0.43
R7135:Rp1 UTSW 1 4348168 missense possibly damaging 0.83
R7165:Rp1 UTSW 1 4349917 missense probably damaging 0.99
R7199:Rp1 UTSW 1 4347290 missense possibly damaging 0.73
R7232:Rp1 UTSW 1 4228601 missense unknown
R7367:Rp1 UTSW 1 4347998 missense probably benign 0.42
R7484:Rp1 UTSW 1 4345481 missense probably benign 0.10
R7500:Rp1 UTSW 1 4311278 missense unknown
R7569:Rp1 UTSW 1 4284840 missense unknown
R7642:Rp1 UTSW 1 4147831 missense unknown
R7693:Rp1 UTSW 1 4347403 missense probably damaging 1.00
R7742:Rp1 UTSW 1 4170234 missense unknown
R7759:Rp1 UTSW 1 4344884 missense probably benign
R7784:Rp1 UTSW 1 4142658 missense unknown
R7816:Rp1 UTSW 1 4347703 missense probably damaging 0.98
R7866:Rp1 UTSW 1 4347701 missense probably benign 0.02
R8215:Rp1 UTSW 1 4245095 missense unknown
R8281:Rp1 UTSW 1 4347916 missense probably damaging 1.00
R8294:Rp1 UTSW 1 4345997 missense probably benign 0.09
R8309:Rp1 UTSW 1 4347089 missense probably benign 0.00
R8311:Rp1 UTSW 1 4348349 missense probably benign 0.11
R8500:Rp1 UTSW 1 4346590 missense possibly damaging 0.91
R8559:Rp1 UTSW 1 4349561 missense probably damaging 1.00
R8672:Rp1 UTSW 1 4348784 missense possibly damaging 0.55
R8688:Rp1 UTSW 1 4346405 missense probably benign 0.01
R8792:Rp1 UTSW 1 4024868 missense unknown
R8859:Rp1 UTSW 1 4349960 missense probably benign 0.07
R8945:Rp1 UTSW 1 4349594 missense probably benign 0.42
R8959:Rp1 UTSW 1 4349427 intron probably benign
R8979:Rp1 UTSW 1 4148714 missense unknown
R9126:Rp1 UTSW 1 4346913 missense probably damaging 0.99
R9156:Rp1 UTSW 1 4163938 missense unknown
R9160:Rp1 UTSW 1 4346497 missense probably benign 0.00
R9221:Rp1 UTSW 1 4245043 missense unknown
R9263:Rp1 UTSW 1 4348452 missense probably benign 0.25
R9263:Rp1 UTSW 1 4348937 missense probably benign 0.02
R9302:Rp1 UTSW 1 4346566 missense probably damaging 1.00
R9318:Rp1 UTSW 1 4348265 missense probably benign 0.09
R9414:Rp1 UTSW 1 4243618 missense unknown
R9478:Rp1 UTSW 1 4347322 missense probably benign 0.06
R9529:Rp1 UTSW 1 4346224 missense probably benign
R9572:Rp1 UTSW 1 4348439 missense probably benign
R9673:Rp1 UTSW 1 4267569 missense unknown
R9709:Rp1 UTSW 1 4042032 missense unknown
R9716:Rp1 UTSW 1 4142610 critical splice donor site probably null
RF003:Rp1 UTSW 1 4344694 missense probably damaging 0.99
V1662:Rp1 UTSW 1 4349560 missense probably damaging 1.00
X0012:Rp1 UTSW 1 4347695 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AACTGCCCTGCTTTGTTTTAAG -3'
(R):5'- TTTCCTATAAAGATGGGGACTGG -3'

Sequencing Primer
(F):5'- ACTGCCCTGCTTTGTTTTAAGATTTC -3'
(R):5'- GGACTGGAAGGTAACCGTTG -3'
Posted On 2022-06-15