Incidental Mutation 'R9474:Grb14'
ID 715610
Institutional Source Beutler Lab
Gene Symbol Grb14
Ensembl Gene ENSMUSG00000026888
Gene Name growth factor receptor bound protein 14
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.152) question?
Stock # R9474 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 64742820-64853143 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 64768744 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Serine at position 189 (Y189S)
Ref Sequence ENSEMBL: ENSMUSP00000028252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028252] [ENSMUST00000156765]
AlphaFold Q9JLM9
Predicted Effect probably damaging
Transcript: ENSMUST00000028252
AA Change: Y189S

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028252
Gene: ENSMUSG00000026888
AA Change: Y189S

DomainStartEndE-ValueType
RA 104 190 2.88e-23 SMART
PH 233 342 1.91e-10 SMART
Pfam:BPS 367 415 1.5e-31 PFAM
SH2 435 524 5.34e-28 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000156765
AA Change: Y104S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121001
Gene: ENSMUSG00000026888
AA Change: Y104S

DomainStartEndE-ValueType
RA 19 105 1.87e-22 SMART
Pfam:PH 148 221 5.3e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to a small family of adapter proteins that are known to interact with a number of receptor tyrosine kinases and signaling molecules. This gene encodes a growth factor receptor-binding protein that interacts with insulin receptors and insulin-like growth-factor receptors. This protein likely has an inhibitory effect on receptor tyrosine kinase signaling and, in particular, on insulin receptor signaling. This gene may play a role in signaling pathways that regulate growth and metabolism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous mutation of this gene results in improved glucose tolerance, lower circulating insulin levels and increased incorporation of glucose into glycogen in the liver and skeletal muscle of males. Both males and females exhibit a decrease in body size. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik C A 10: 78,903,565 (GRCm39) K250N probably damaging Het
Adam5 A T 8: 25,237,540 (GRCm39) D623E possibly damaging Het
Akt3 T C 1: 176,852,952 (GRCm39) Y473C probably damaging Het
Ankib1 A G 5: 3,805,617 (GRCm39) Y217H probably damaging Het
Clca4b T A 3: 144,616,927 (GRCm39) T908S probably benign Het
Clec7a G A 6: 129,440,126 (GRCm39) Q160* probably null Het
Cntnap4 T A 8: 113,460,103 (GRCm39) I152N probably damaging Het
Ctdspl C T 9: 118,866,445 (GRCm39) A179V probably damaging Het
Ddx43 T C 9: 78,313,668 (GRCm39) S200P probably damaging Het
Dip2c A G 13: 9,544,963 (GRCm39) D84G unknown Het
Dmbt1 G A 7: 130,675,987 (GRCm39) R625H unknown Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 72,684,217 (GRCm39) probably benign Het
E2f7 C T 10: 110,603,050 (GRCm39) T355I probably damaging Het
E2f7 C A 10: 110,614,918 (GRCm39) L541M probably damaging Het
Elovl5 T A 9: 77,890,007 (GRCm39) S273T possibly damaging Het
Emc1 T A 4: 139,093,705 (GRCm39) L605Q probably damaging Het
Fras1 T A 5: 96,887,124 (GRCm39) D2635E probably benign Het
Gabrb1 G A 5: 72,265,690 (GRCm39) G195E probably damaging Het
Galm A G 17: 80,457,561 (GRCm39) D199G possibly damaging Het
Galntl6 T G 8: 58,230,359 (GRCm39) S20R probably damaging Het
Hk2 T A 6: 82,705,895 (GRCm39) I803F probably damaging Het
Hmcn1 G A 1: 150,506,471 (GRCm39) R3779W probably damaging Het
Hmgcr A C 13: 96,796,403 (GRCm39) M260R probably damaging Het
Hsbp1l1 T A 18: 80,276,639 (GRCm39) K68N possibly damaging Het
Inhba A C 13: 16,192,263 (GRCm39) E128A probably benign Het
Itpr3 G A 17: 27,337,651 (GRCm39) probably benign Het
Klhl3 G A 13: 58,167,273 (GRCm39) P364S probably damaging Het
Lhpp T C 7: 132,243,312 (GRCm39) L176P probably damaging Het
Lrp1b C A 2: 40,491,599 (GRCm39) A223S probably damaging Het
Lrp3 A G 7: 34,903,489 (GRCm39) F286L probably damaging Het
Lrrc7 T C 3: 157,841,028 (GRCm39) T1337A probably benign Het
Magi2 A G 5: 20,400,019 (GRCm39) D17G probably benign Het
Map3k21 T C 8: 126,650,903 (GRCm39) S302P probably damaging Het
Matcap2 T C 9: 22,343,015 (GRCm39) M303T probably damaging Het
Mbtd1 A G 11: 93,816,511 (GRCm39) D386G probably benign Het
Mfsd2b A T 12: 4,916,820 (GRCm39) D306E possibly damaging Het
Muc20 T C 16: 32,614,453 (GRCm39) E308G probably damaging Het
Myh13 G A 11: 67,255,712 (GRCm39) S34N Het
Nebl C A 2: 17,374,421 (GRCm39) G894* probably null Het
Nelfa A G 5: 34,056,095 (GRCm39) Y523H probably damaging Het
Ninj1 A G 13: 49,341,076 (GRCm39) D13G probably benign Het
Ninl A T 2: 150,782,726 (GRCm39) S170T probably benign Het
Nlrp4c G A 7: 6,068,626 (GRCm39) V176M possibly damaging Het
Nobox G A 6: 43,284,115 (GRCm39) R144C probably damaging Het
Oas1a G A 5: 121,037,317 (GRCm39) L237F probably damaging Het
Or4a81 A C 2: 89,619,506 (GRCm39) Y63* probably null Het
Or52z15 A T 7: 103,332,477 (GRCm39) Y184F probably damaging Het
Or5w20 T C 2: 87,726,693 (GRCm39) M50T probably benign Het
Or6z1 A G 7: 6,505,150 (GRCm39) L25P probably benign Het
Or7c70 T C 10: 78,682,891 (GRCm39) N286S probably damaging Het
Or8h9 A G 2: 86,789,757 (GRCm39) M15T probably benign Het
Orai1 A G 5: 123,167,301 (GRCm39) N158S probably damaging Het
Pa2g4 C A 10: 128,398,967 (GRCm39) V121L probably benign Het
Pclo T C 5: 14,571,250 (GRCm39) S212P possibly damaging Het
Plce1 G A 19: 38,766,337 (GRCm39) E2121K possibly damaging Het
Plg A G 17: 12,622,024 (GRCm39) Y448C probably damaging Het
Plppr4 A T 3: 117,116,866 (GRCm39) N330K probably damaging Het
Pou2f2 A G 7: 24,794,247 (GRCm39) L373S probably benign Het
Rnpep A G 1: 135,211,341 (GRCm39) F136L probably benign Het
Rp1 A G 1: 4,162,838 (GRCm39) probably null Het
Shank1 G A 7: 43,962,342 (GRCm39) S71N unknown Het
Slc5a4a GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC 10: 75,986,238 (GRCm39) probably benign Het
Slc5a5 T C 8: 71,337,596 (GRCm39) D574G probably benign Het
Slc7a15 T A 12: 8,588,794 (GRCm39) N251I probably damaging Het
Speer4a3 A T 5: 26,158,136 (GRCm39) I72N probably damaging Het
Susd4 T C 1: 182,719,665 (GRCm39) S427P probably benign Het
Tarbp1 T A 8: 127,155,779 (GRCm39) T1320S probably benign Het
Tbpl2 C T 2: 23,984,650 (GRCm39) V166I probably benign Het
Thbs1 T C 2: 117,950,518 (GRCm39) probably null Het
Tnfsf13b A G 8: 10,081,648 (GRCm39) Y270C probably damaging Het
Vps11 G T 9: 44,260,290 (GRCm39) C857* probably null Het
Vsig10 G A 5: 117,463,104 (GRCm39) R110H probably benign Het
Wee2 T A 6: 40,432,044 (GRCm39) Y204* probably null Het
Zfpm2 T A 15: 40,966,867 (GRCm39) S1117R probably damaging Het
Zscan5b A G 7: 6,234,472 (GRCm39) N166S probably benign Het
Other mutations in Grb14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Grb14 APN 2 64,745,062 (GRCm39) missense probably damaging 1.00
IGL02267:Grb14 APN 2 64,783,960 (GRCm39) missense probably damaging 1.00
IGL02902:Grb14 APN 2 64,768,762 (GRCm39) missense probably damaging 1.00
R0066:Grb14 UTSW 2 64,768,836 (GRCm39) critical splice acceptor site probably null
R0066:Grb14 UTSW 2 64,768,836 (GRCm39) critical splice acceptor site probably null
R0658:Grb14 UTSW 2 64,745,071 (GRCm39) nonsense probably null
R0681:Grb14 UTSW 2 64,747,631 (GRCm39) missense probably damaging 1.00
R1215:Grb14 UTSW 2 64,747,608 (GRCm39) missense probably benign 0.01
R1781:Grb14 UTSW 2 64,805,899 (GRCm39) critical splice donor site probably null
R1932:Grb14 UTSW 2 64,743,146 (GRCm39) missense probably damaging 1.00
R2034:Grb14 UTSW 2 64,753,873 (GRCm39) splice site probably benign
R4405:Grb14 UTSW 2 64,783,966 (GRCm39) missense probably damaging 1.00
R4505:Grb14 UTSW 2 64,852,912 (GRCm39) missense probably damaging 0.97
R4580:Grb14 UTSW 2 64,783,947 (GRCm39) missense probably benign 0.29
R5216:Grb14 UTSW 2 64,747,653 (GRCm39) missense probably benign 0.00
R5367:Grb14 UTSW 2 64,747,653 (GRCm39) missense probably benign 0.00
R5369:Grb14 UTSW 2 64,747,653 (GRCm39) missense probably benign 0.00
R5382:Grb14 UTSW 2 64,745,078 (GRCm39) missense probably damaging 1.00
R5457:Grb14 UTSW 2 64,747,442 (GRCm39) missense probably damaging 1.00
R5816:Grb14 UTSW 2 64,747,628 (GRCm39) missense probably damaging 1.00
R6062:Grb14 UTSW 2 64,852,964 (GRCm39) missense possibly damaging 0.77
R7114:Grb14 UTSW 2 64,747,197 (GRCm39) missense probably damaging 1.00
R8290:Grb14 UTSW 2 64,805,929 (GRCm39) missense probably benign 0.02
R8540:Grb14 UTSW 2 64,851,478 (GRCm39) missense probably benign 0.14
R9318:Grb14 UTSW 2 64,852,985 (GRCm39) missense probably damaging 1.00
R9572:Grb14 UTSW 2 64,763,680 (GRCm39) missense probably damaging 0.99
X0021:Grb14 UTSW 2 64,766,769 (GRCm39) missense probably null 0.26
Predicted Primers PCR Primer
(F):5'- CAGGCATCATGTTAGCTCATTATCG -3'
(R):5'- GCCTTGCCAGTGTAGCTATTTAAG -3'

Sequencing Primer
(F):5'- TATCGTTAAAATAGGGCCTCAGAGC -3'
(R):5'- CTATTTAAGATTTGAGATGGAGCTGC -3'
Posted On 2022-06-15