Mutagenetix > Incidental Mutation

Incidental Mutation 'R9474:Grb14'

715610

Institutional Source

Beutler Lab

Gene Symbol

Grb14

Ensembl Gene

ENSMUSG00000026888

Gene Name

growth factor receptor bound protein 14

Synonyms

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_016719.1; MGI:1355324

Essential gene?

Probably non essential (E-score: 0.156) question?

Stock #

R9474 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

64912476-65024987 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 64938400 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Serine at position 189 (Y189S)

Ref Sequence

ENSEMBL: ENSMUSP00000028252 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028252] [ENSMUST00000156765]

AlphaFold

Q9JLM9

Predicted Effect

probably damaging
Transcript: ENSMUST00000028252
AA Change: Y189S

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000028252
Gene: ENSMUSG00000026888
AA Change: Y189S

Domain	Start	End	E-Value	Type
RA	104	190	2.88e-23	SMART
PH	233	342	1.91e-10	SMART
Pfam:BPS	367	415	1.5e-31	PFAM
SH2	435	524	5.34e-28	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000156765
AA Change: Y104S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000121001
Gene: ENSMUSG00000026888
AA Change: Y104S

Domain	Start	End	E-Value	Type
RA	19	105	1.87e-22	SMART
Pfam:PH	148	221	5.3e-8	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

Strain: 3029164
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to a small family of adapter proteins that are known to interact with a number of receptor tyrosine kinases and signaling molecules. This gene encodes a growth factor receptor-binding protein that interacts with insulin receptors and insulin-like growth-factor receptors. This protein likely has an inhibitory effect on receptor tyrosine kinase signaling and, in particular, on insulin receptor signaling. This gene may play a role in signaling pathways that regulate growth and metabolism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous mutation of this gene results in improved glucose tolerance, lower circulating insulin levels and increased incorporation of glucose into glycogen in the liver and skeletal muscle of males. Both males and females exhibit a decrease in body size. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610008E11Rik	C	A	10: 79,067,731	K250N	probably damaging	Het
9530077C05Rik	T	C	9: 22,431,719	M303T	probably damaging	Het
Adam5	A	T	8: 24,747,524	D623E	possibly damaging	Het
Akt3	T	C	1: 177,025,386	Y473C	probably damaging	Het
Ankib1	A	G	5: 3,755,617	Y217H	probably damaging	Het
Clca4b	T	A	3: 144,911,166	T908S	probably benign	Het
Clec7a	G	A	6: 129,463,163	Q160*	probably null	Het
Cntnap4	T	A	8: 112,733,471	I152N	probably damaging	Het
Ctdspl	C	T	9: 119,037,377	A179V	probably damaging	Het
Ddx43	T	C	9: 78,406,386	S200P	probably damaging	Het
Dip2c	A	G	13: 9,494,927	D84G	unknown	Het
Dmbt1	G	A	7: 131,074,257	R625H	unknown	Het
Dusp9	TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG	TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG	X: 73,640,611		probably benign	Het
E2f7	C	T	10: 110,767,189	T355I	probably damaging	Het
E2f7	C	A	10: 110,779,057	L541M	probably damaging	Het
Elovl5	T	A	9: 77,982,725	S273T	possibly damaging	Het
Emc1	T	A	4: 139,366,394	L605Q	probably damaging	Het
Fras1	T	A	5: 96,739,265	D2635E	probably benign	Het
Gabrb1	G	A	5: 72,108,347	G195E	probably damaging	Het
Galm	A	G	17: 80,150,132	D199G	possibly damaging	Het
Galntl6	T	G	8: 57,777,325	S20R	probably damaging	Het
Gm21671	A	T	5: 25,953,138	I72N	probably damaging	Het
Hk2	T	A	6: 82,728,914	I803F	probably damaging	Het
Hmcn1	G	A	1: 150,630,720	R3779W	probably damaging	Het
Hmgcr	A	C	13: 96,659,895	M260R	probably damaging	Het
Hsbp1l1	T	A	18: 80,233,424	K68N	possibly damaging	Het
Inhba	A	C	13: 16,017,678	E128A	probably benign	Het
Itpr3	G	A	17: 27,118,677		probably benign	Het
Klhl3	G	A	13: 58,019,459	P364S	probably damaging	Het
Lhpp	T	C	7: 132,641,583	L176P	probably damaging	Het
Lrp1b	C	A	2: 40,601,587	A223S	probably damaging	Het
Lrp3	A	G	7: 35,204,064	F286L	probably damaging	Het
Lrrc7	T	C	3: 158,135,391	T1337A	probably benign	Het
Magi2	A	G	5: 20,195,021	D17G	probably benign	Het
Map3k21	T	C	8: 125,924,164	S302P	probably damaging	Het
Mbtd1	A	G	11: 93,925,685	D386G	probably benign	Het
Mfsd2b	A	T	12: 4,866,820	D306E	possibly damaging	Het
Muc20	T	C	16: 32,794,083	E308G	probably damaging	Het
Myh13	G	A	11: 67,364,886	S34N		Het
Nebl	C	A	2: 17,369,610	G894*	probably null	Het
Nelfa	A	G	5: 33,898,751	Y523H	probably damaging	Het
Ninj1	A	G	13: 49,187,600	D13G	probably benign	Het
Ninl	A	T	2: 150,940,806	S170T	probably benign	Het
Nlrp4c	G	A	7: 6,065,627	V176M	possibly damaging	Het
Nobox	G	A	6: 43,307,181	R144C	probably damaging	Het
Oas1a	G	A	5: 120,899,254	L237F	probably damaging	Het
Olfr1099	A	G	2: 86,959,413	M15T	probably benign	Het
Olfr1153	T	C	2: 87,896,349	M50T	probably benign	Het
Olfr1254	A	C	2: 89,789,162	Y63*	probably null	Het
Olfr1348	A	G	7: 6,502,151	L25P	probably benign	Het
Olfr1356	T	C	10: 78,847,057	N286S	probably damaging	Het
Olfr625-ps1	A	T	7: 103,683,270	Y184F	probably damaging	Het
Orai1	A	G	5: 123,029,238	N158S	probably damaging	Het
Pa2g4	C	A	10: 128,563,098	V121L	probably benign	Het
Pclo	T	C	5: 14,521,236	S212P	possibly damaging	Het
Plce1	G	A	19: 38,777,893	E2121K	possibly damaging	Het
Plg	A	G	17: 12,403,137	Y448C	probably damaging	Het
Plppr4	A	T	3: 117,323,217	N330K	probably damaging	Het
Pou2f2	A	G	7: 25,094,822	L373S	probably benign	Het
Rnpep	A	G	1: 135,283,603	F136L	probably benign	Het
Rp1	A	G	1: 4,092,615		probably null	Het
Shank1	G	A	7: 44,312,918	S71N	unknown	Het
Slc5a4a	GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC	GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC	10: 76,150,404		probably benign	Het
Slc5a5	T	C	8: 70,884,952	D574G	probably benign	Het
Slc7a15	T	A	12: 8,538,794	N251I	probably damaging	Het
Susd4	T	C	1: 182,892,100	S427P	probably benign	Het
Tarbp1	T	A	8: 126,429,040	T1320S	probably benign	Het
Tbpl2	C	T	2: 24,094,638	V166I	probably benign	Het
Thbs1	T	C	2: 118,120,037		probably null	Het
Tnfsf13b	A	G	8: 10,031,648	Y270C	probably damaging	Het
Vps11	G	T	9: 44,348,993	C857*	probably null	Het
Vsig10	G	A	5: 117,325,039	R110H	probably benign	Het
Wee2	T	A	6: 40,455,110	Y204*	probably null	Het
Zfpm2	T	A	15: 41,103,471	S1117R	probably damaging	Het
Zscan5b	A	G	7: 6,231,473	N166S	probably benign	Het

Other mutations in Grb14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00780:Grb14	APN	2	64914718	missense	probably damaging	1.00
IGL02267:Grb14	APN	2	64953616	missense	probably damaging	1.00
IGL02902:Grb14	APN	2	64938418	missense	probably damaging	1.00
R0066:Grb14	UTSW	2	64938492	critical splice acceptor site	probably null
R0066:Grb14	UTSW	2	64938492	critical splice acceptor site	probably null
R0658:Grb14	UTSW	2	64914727	nonsense	probably null
R0681:Grb14	UTSW	2	64917287	missense	probably damaging	1.00
R1215:Grb14	UTSW	2	64917264	missense	probably benign	0.01
R1781:Grb14	UTSW	2	64975555	critical splice donor site	probably null
R1932:Grb14	UTSW	2	64912802	missense	probably damaging	1.00
R2034:Grb14	UTSW	2	64923529	splice site	probably benign
R4405:Grb14	UTSW	2	64953622	missense	probably damaging	1.00
R4505:Grb14	UTSW	2	65022568	missense	probably damaging	0.97
R4580:Grb14	UTSW	2	64953603	missense	probably benign	0.29
R5216:Grb14	UTSW	2	64917309	missense	probably benign	0.00
R5367:Grb14	UTSW	2	64917309	missense	probably benign	0.00
R5369:Grb14	UTSW	2	64917309	missense	probably benign	0.00
R5382:Grb14	UTSW	2	64914734	missense	probably damaging	1.00
R5457:Grb14	UTSW	2	64917098	missense	probably damaging	1.00
R5816:Grb14	UTSW	2	64917284	missense	probably damaging	1.00
R6062:Grb14	UTSW	2	65022620	missense	possibly damaging	0.77
R7114:Grb14	UTSW	2	64916853	missense	probably damaging	1.00
R8290:Grb14	UTSW	2	64975585	missense	probably benign	0.02
R8540:Grb14	UTSW	2	65021134	missense	probably benign	0.14
R9318:Grb14	UTSW	2	65022641	missense	probably damaging	1.00
R9572:Grb14	UTSW	2	64933336	missense	probably damaging	0.99
X0021:Grb14	UTSW	2	64936425	missense	probably null	0.26

Predicted Primers

PCR Primer
(F):5'- CAGGCATCATGTTAGCTCATTATCG -3'
(R):5'- GCCTTGCCAGTGTAGCTATTTAAG -3'

Sequencing Primer
(F):5'- TATCGTTAAAATAGGGCCTCAGAGC -3'
(R):5'- CTATTTAAGATTTGAGATGGAGCTGC -3'

Posted On

2022-06-15