Mutagenetix > Incidental Mutation

Incidental Mutation 'R9474:Plppr4'

715616

Institutional Source

Beutler Lab

Gene Symbol

Plppr4

Ensembl Gene

ENSMUSG00000044667

Gene Name

phospholipid phosphatase related 4

Synonyms

Lppr4, D3Bwg0562e

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9474 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

117319139-117360876 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 117323217 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 330 (N330K)

Ref Sequence

ENSEMBL: ENSMUSP00000052306 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061071] [ENSMUST00000197743]

AlphaFold

Q7TME0

Predicted Effect

probably damaging
Transcript: ENSMUST00000061071
AA Change: N330K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000052306
Gene: ENSMUSG00000044667
AA Change: N330K

Domain	Start	End	E-Value	Type
acidPPc	180	324	4.07e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000197743
AA Change: N272K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000143753
Gene: ENSMUSG00000044667
AA Change: N272K

Domain	Start	End	E-Value	Type
SCOP:d1d2ta_	59	268	1e-7	SMART
Blast:acidPPc	180	265	8e-53	BLAST

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the lipid phosphate phosphatase (LPP) family. LPPs catalyze the dephosphorylation of a number of bioactive lipid mediators that regulate a variety of cell functions. This protein is specifically expressed in neurons. It is located in the membranes of outgrowing axons and has been shown to be important for axonal outgrowth during development and regenerative sprouting. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced body weight, seizures, hyperexcitability of evoked fEPSP, and premature lethality around 3 weeks of age. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610008E11Rik	C	A	10: 79,067,731	K250N	probably damaging	Het
9530077C05Rik	T	C	9: 22,431,719	M303T	probably damaging	Het
Adam5	A	T	8: 24,747,524	D623E	possibly damaging	Het
Akt3	T	C	1: 177,025,386	Y473C	probably damaging	Het
Ankib1	A	G	5: 3,755,617	Y217H	probably damaging	Het
Clca4b	T	A	3: 144,911,166	T908S	probably benign	Het
Clec7a	G	A	6: 129,463,163	Q160*	probably null	Het
Cntnap4	T	A	8: 112,733,471	I152N	probably damaging	Het
Ctdspl	C	T	9: 119,037,377	A179V	probably damaging	Het
Ddx43	T	C	9: 78,406,386	S200P	probably damaging	Het
Dip2c	A	G	13: 9,494,927	D84G	unknown	Het
Dmbt1	G	A	7: 131,074,257	R625H	unknown	Het
Dusp9	TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG	TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG	X: 73,640,611		probably benign	Het
E2f7	C	T	10: 110,767,189	T355I	probably damaging	Het
E2f7	C	A	10: 110,779,057	L541M	probably damaging	Het
Elovl5	T	A	9: 77,982,725	S273T	possibly damaging	Het
Emc1	T	A	4: 139,366,394	L605Q	probably damaging	Het
Fras1	T	A	5: 96,739,265	D2635E	probably benign	Het
Gabrb1	G	A	5: 72,108,347	G195E	probably damaging	Het
Galm	A	G	17: 80,150,132	D199G	possibly damaging	Het
Galntl6	T	G	8: 57,777,325	S20R	probably damaging	Het
Gm21671	A	T	5: 25,953,138	I72N	probably damaging	Het
Grb14	T	G	2: 64,938,400	Y189S	probably damaging	Het
Hk2	T	A	6: 82,728,914	I803F	probably damaging	Het
Hmcn1	G	A	1: 150,630,720	R3779W	probably damaging	Het
Hmgcr	A	C	13: 96,659,895	M260R	probably damaging	Het
Hsbp1l1	T	A	18: 80,233,424	K68N	possibly damaging	Het
Inhba	A	C	13: 16,017,678	E128A	probably benign	Het
Itpr3	G	A	17: 27,118,677		probably benign	Het
Klhl3	G	A	13: 58,019,459	P364S	probably damaging	Het
Lhpp	T	C	7: 132,641,583	L176P	probably damaging	Het
Lrp1b	C	A	2: 40,601,587	A223S	probably damaging	Het
Lrp3	A	G	7: 35,204,064	F286L	probably damaging	Het
Lrrc7	T	C	3: 158,135,391	T1337A	probably benign	Het
Magi2	A	G	5: 20,195,021	D17G	probably benign	Het
Map3k21	T	C	8: 125,924,164	S302P	probably damaging	Het
Mbtd1	A	G	11: 93,925,685	D386G	probably benign	Het
Mfsd2b	A	T	12: 4,866,820	D306E	possibly damaging	Het
Muc20	T	C	16: 32,794,083	E308G	probably damaging	Het
Myh13	G	A	11: 67,364,886	S34N		Het
Nebl	C	A	2: 17,369,610	G894*	probably null	Het
Nelfa	A	G	5: 33,898,751	Y523H	probably damaging	Het
Ninj1	A	G	13: 49,187,600	D13G	probably benign	Het
Ninl	A	T	2: 150,940,806	S170T	probably benign	Het
Nlrp4c	G	A	7: 6,065,627	V176M	possibly damaging	Het
Nobox	G	A	6: 43,307,181	R144C	probably damaging	Het
Oas1a	G	A	5: 120,899,254	L237F	probably damaging	Het
Olfr1099	A	G	2: 86,959,413	M15T	probably benign	Het
Olfr1153	T	C	2: 87,896,349	M50T	probably benign	Het
Olfr1254	A	C	2: 89,789,162	Y63*	probably null	Het
Olfr1348	A	G	7: 6,502,151	L25P	probably benign	Het
Olfr1356	T	C	10: 78,847,057	N286S	probably damaging	Het
Olfr625-ps1	A	T	7: 103,683,270	Y184F	probably damaging	Het
Orai1	A	G	5: 123,029,238	N158S	probably damaging	Het
Pa2g4	C	A	10: 128,563,098	V121L	probably benign	Het
Pclo	T	C	5: 14,521,236	S212P	possibly damaging	Het
Plce1	G	A	19: 38,777,893	E2121K	possibly damaging	Het
Plg	A	G	17: 12,403,137	Y448C	probably damaging	Het
Pou2f2	A	G	7: 25,094,822	L373S	probably benign	Het
Rnpep	A	G	1: 135,283,603	F136L	probably benign	Het
Rp1	A	G	1: 4,092,615		probably null	Het
Shank1	G	A	7: 44,312,918	S71N	unknown	Het
Slc5a4a	GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC	GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC	10: 76,150,404		probably benign	Het
Slc5a5	T	C	8: 70,884,952	D574G	probably benign	Het
Slc7a15	T	A	12: 8,538,794	N251I	probably damaging	Het
Susd4	T	C	1: 182,892,100	S427P	probably benign	Het
Tarbp1	T	A	8: 126,429,040	T1320S	probably benign	Het
Tbpl2	C	T	2: 24,094,638	V166I	probably benign	Het
Thbs1	T	C	2: 118,120,037		probably null	Het
Tnfsf13b	A	G	8: 10,031,648	Y270C	probably damaging	Het
Vps11	G	T	9: 44,348,993	C857*	probably null	Het
Vsig10	G	A	5: 117,325,039	R110H	probably benign	Het
Wee2	T	A	6: 40,455,110	Y204*	probably null	Het
Zfpm2	T	A	15: 41,103,471	S1117R	probably damaging	Het
Zscan5b	A	G	7: 6,231,473	N166S	probably benign	Het

Other mutations in Plppr4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Plppr4	APN	3	117322220	missense	probably benign	0.01
IGL01969:Plppr4	APN	3	117328359	missense	probably damaging	1.00
IGL02014:Plppr4	APN	3	117335573	missense	probably damaging	1.00
IGL02068:Plppr4	APN	3	117331784	splice site	probably benign
IGL02426:Plppr4	APN	3	117322295	missense	probably benign	0.01
IGL03203:Plppr4	APN	3	117325891	missense	possibly damaging	0.89
PIT4445001:Plppr4	UTSW	3	117360308	unclassified	probably benign
R0376:Plppr4	UTSW	3	117323091	missense	probably benign	0.05
R0755:Plppr4	UTSW	3	117322670	missense	possibly damaging	0.68
R0831:Plppr4	UTSW	3	117331646	critical splice donor site	probably null
R1518:Plppr4	UTSW	3	117335503	missense	probably damaging	1.00
R1523:Plppr4	UTSW	3	117322841	missense	probably damaging	1.00
R1581:Plppr4	UTSW	3	117328266	missense	possibly damaging	0.58
R1628:Plppr4	UTSW	3	117328272	missense	probably damaging	1.00
R2510:Plppr4	UTSW	3	117331706	missense	probably damaging	0.99
R2511:Plppr4	UTSW	3	117331706	missense	probably damaging	0.99
R4332:Plppr4	UTSW	3	117322825	missense	probably benign
R4380:Plppr4	UTSW	3	117322397	missense	probably benign	0.40
R4787:Plppr4	UTSW	3	117322330	missense	probably damaging	0.99
R4829:Plppr4	UTSW	3	117335591	missense	possibly damaging	0.94
R5511:Plppr4	UTSW	3	117325902	missense	probably benign	0.39
R5819:Plppr4	UTSW	3	117325864	missense	possibly damaging	0.89
R6149:Plppr4	UTSW	3	117322394	missense	probably benign	0.22
R6257:Plppr4	UTSW	3	117322579	missense	possibly damaging	0.49
R6974:Plppr4	UTSW	3	117323018	missense	probably damaging	1.00
R7045:Plppr4	UTSW	3	117360034	missense	probably damaging	1.00
R7102:Plppr4	UTSW	3	117323183	missense	probably damaging	0.98
R7507:Plppr4	UTSW	3	117322105	missense	possibly damaging	0.76
R7820:Plppr4	UTSW	3	117321949	missense	possibly damaging	0.88
R8179:Plppr4	UTSW	3	117331678	missense	probably damaging	1.00
R8181:Plppr4	UTSW	3	117322465	missense	probably damaging	1.00
R8391:Plppr4	UTSW	3	117335411	missense	probably benign	0.02
R8531:Plppr4	UTSW	3	117321943	missense	probably damaging	1.00
R8762:Plppr4	UTSW	3	117325833	missense	probably damaging	1.00
R8784:Plppr4	UTSW	3	117322541	nonsense	probably null
R8933:Plppr4	UTSW	3	117323041	missense	probably damaging	1.00
R9251:Plppr4	UTSW	3	117321959	missense	probably benign	0.22
R9311:Plppr4	UTSW	3	117325869	missense	probably damaging	0.99
R9385:Plppr4	UTSW	3	117322728	missense	possibly damaging	0.94
R9612:Plppr4	UTSW	3	117321961	missense	probably benign	0.07
R9709:Plppr4	UTSW	3	117328327	missense	possibly damaging	0.83
Z1176:Plppr4	UTSW	3	117322849	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAAGGAGCTTGCATCCCTG -3'
(R):5'- GGTCCAGACAGTTAAGAGCTACATAC -3'

Sequencing Primer
(F):5'- GAGCTTGCATCCCTGTGGTTTC -3'
(R):5'- GAGCTACATACACCACTATTATCCC -3'

Posted On

2022-06-15