Incidental Mutation 'R9474:Lrrc7'
ID 715618
Institutional Source Beutler Lab
Gene Symbol Lrrc7
Ensembl Gene ENSMUSG00000028176
Gene Name leucine rich repeat containing 7
Synonyms densin
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.748) question?
Stock # R9474 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 157788528-158267858 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 157841028 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1337 (T1337A)
Ref Sequence ENSEMBL: ENSMUSP00000142498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106044] [ENSMUST00000199890] [ENSMUST00000200137]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000106044
AA Change: T1384A

PolyPhen 2 Score 0.594 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101659
Gene: ENSMUSG00000028176
AA Change: T1384A

DomainStartEndE-ValueType
LRR 53 73 3.65e0 SMART
LRR 96 118 2.2e1 SMART
LRR 142 164 4.21e1 SMART
LRR 165 187 7.36e0 SMART
LRR 188 210 7.05e-1 SMART
LRR 211 233 3.09e1 SMART
LRR 234 257 4.21e1 SMART
LRR 258 279 2.61e2 SMART
LRR 280 303 3.52e-1 SMART
LRR 326 349 1.99e0 SMART
LRR 372 394 2.63e0 SMART
low complexity region 466 476 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
Blast:PDZ 708 736 1e-5 BLAST
low complexity region 787 797 N/A INTRINSIC
low complexity region 864 878 N/A INTRINSIC
Blast:PDZ 1349 1378 2e-11 BLAST
PDZ 1460 1540 1.33e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199890
AA Change: T1297A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142440
Gene: ENSMUSG00000028176
AA Change: T1297A

DomainStartEndE-ValueType
LRR 53 73 3.65e0 SMART
LRR 96 118 2.2e1 SMART
LRR 142 164 4.21e1 SMART
LRR 165 187 7.36e0 SMART
LRR 188 210 7.05e-1 SMART
LRR 211 233 3.09e1 SMART
LRR 234 257 4.21e1 SMART
LRR 258 279 2.61e2 SMART
LRR 280 303 3.52e-1 SMART
LRR 326 349 1.99e0 SMART
LRR 372 394 2.63e0 SMART
low complexity region 466 476 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
Blast:PDZ 708 736 9e-6 BLAST
low complexity region 787 797 N/A INTRINSIC
low complexity region 864 878 N/A INTRINSIC
Blast:PDZ 1328 1364 1e-15 BLAST
low complexity region 1374 1387 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200137
AA Change: T1337A

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000142498
Gene: ENSMUSG00000028176
AA Change: T1337A

DomainStartEndE-ValueType
LRR 52 69 7.6e-1 SMART
LRR 73 92 4.2e-1 SMART
LRR 96 115 3.4e-1 SMART
LRR 142 164 1.8e-1 SMART
LRR 165 184 1.5e-1 SMART
LRR 188 207 2e-2 SMART
LRR 211 233 1.3e-1 SMART
LRR 234 257 1.7e-1 SMART
LRR 257 276 1e0 SMART
LRR 280 299 3.1e-2 SMART
LRR 303 322 6.6e-1 SMART
LRR 326 345 2.1e-1 SMART
LRR 372 391 1.2e-1 SMART
low complexity region 466 476 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
Blast:PDZ 708 736 1e-5 BLAST
low complexity region 787 797 N/A INTRINSIC
low complexity region 864 878 N/A INTRINSIC
Blast:PDZ 1302 1331 2e-11 BLAST
PDZ 1413 1493 6.4e-22 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit limb grasping, reduced long term depression, increased anxiety, increased aggression towards other mice, impaired spatial memory, decreased prepulse inhibition, decreased nesting building behavior, and abnormal dendritic spines. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik C A 10: 78,903,565 (GRCm39) K250N probably damaging Het
Adam5 A T 8: 25,237,540 (GRCm39) D623E possibly damaging Het
Akt3 T C 1: 176,852,952 (GRCm39) Y473C probably damaging Het
Ankib1 A G 5: 3,805,617 (GRCm39) Y217H probably damaging Het
Clca4b T A 3: 144,616,927 (GRCm39) T908S probably benign Het
Clec7a G A 6: 129,440,126 (GRCm39) Q160* probably null Het
Cntnap4 T A 8: 113,460,103 (GRCm39) I152N probably damaging Het
Ctdspl C T 9: 118,866,445 (GRCm39) A179V probably damaging Het
Ddx43 T C 9: 78,313,668 (GRCm39) S200P probably damaging Het
Dip2c A G 13: 9,544,963 (GRCm39) D84G unknown Het
Dmbt1 G A 7: 130,675,987 (GRCm39) R625H unknown Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 72,684,217 (GRCm39) probably benign Het
E2f7 C T 10: 110,603,050 (GRCm39) T355I probably damaging Het
E2f7 C A 10: 110,614,918 (GRCm39) L541M probably damaging Het
Elovl5 T A 9: 77,890,007 (GRCm39) S273T possibly damaging Het
Emc1 T A 4: 139,093,705 (GRCm39) L605Q probably damaging Het
Fras1 T A 5: 96,887,124 (GRCm39) D2635E probably benign Het
Gabrb1 G A 5: 72,265,690 (GRCm39) G195E probably damaging Het
Galm A G 17: 80,457,561 (GRCm39) D199G possibly damaging Het
Galntl6 T G 8: 58,230,359 (GRCm39) S20R probably damaging Het
Grb14 T G 2: 64,768,744 (GRCm39) Y189S probably damaging Het
Hk2 T A 6: 82,705,895 (GRCm39) I803F probably damaging Het
Hmcn1 G A 1: 150,506,471 (GRCm39) R3779W probably damaging Het
Hmgcr A C 13: 96,796,403 (GRCm39) M260R probably damaging Het
Hsbp1l1 T A 18: 80,276,639 (GRCm39) K68N possibly damaging Het
Inhba A C 13: 16,192,263 (GRCm39) E128A probably benign Het
Itpr3 G A 17: 27,337,651 (GRCm39) probably benign Het
Klhl3 G A 13: 58,167,273 (GRCm39) P364S probably damaging Het
Lhpp T C 7: 132,243,312 (GRCm39) L176P probably damaging Het
Lrp1b C A 2: 40,491,599 (GRCm39) A223S probably damaging Het
Lrp3 A G 7: 34,903,489 (GRCm39) F286L probably damaging Het
Magi2 A G 5: 20,400,019 (GRCm39) D17G probably benign Het
Map3k21 T C 8: 126,650,903 (GRCm39) S302P probably damaging Het
Matcap2 T C 9: 22,343,015 (GRCm39) M303T probably damaging Het
Mbtd1 A G 11: 93,816,511 (GRCm39) D386G probably benign Het
Mfsd2b A T 12: 4,916,820 (GRCm39) D306E possibly damaging Het
Muc20 T C 16: 32,614,453 (GRCm39) E308G probably damaging Het
Myh13 G A 11: 67,255,712 (GRCm39) S34N Het
Nebl C A 2: 17,374,421 (GRCm39) G894* probably null Het
Nelfa A G 5: 34,056,095 (GRCm39) Y523H probably damaging Het
Ninj1 A G 13: 49,341,076 (GRCm39) D13G probably benign Het
Ninl A T 2: 150,782,726 (GRCm39) S170T probably benign Het
Nlrp4c G A 7: 6,068,626 (GRCm39) V176M possibly damaging Het
Nobox G A 6: 43,284,115 (GRCm39) R144C probably damaging Het
Oas1a G A 5: 121,037,317 (GRCm39) L237F probably damaging Het
Or4a81 A C 2: 89,619,506 (GRCm39) Y63* probably null Het
Or52z15 A T 7: 103,332,477 (GRCm39) Y184F probably damaging Het
Or5w20 T C 2: 87,726,693 (GRCm39) M50T probably benign Het
Or6z1 A G 7: 6,505,150 (GRCm39) L25P probably benign Het
Or7c70 T C 10: 78,682,891 (GRCm39) N286S probably damaging Het
Or8h9 A G 2: 86,789,757 (GRCm39) M15T probably benign Het
Orai1 A G 5: 123,167,301 (GRCm39) N158S probably damaging Het
Pa2g4 C A 10: 128,398,967 (GRCm39) V121L probably benign Het
Pclo T C 5: 14,571,250 (GRCm39) S212P possibly damaging Het
Plce1 G A 19: 38,766,337 (GRCm39) E2121K possibly damaging Het
Plg A G 17: 12,622,024 (GRCm39) Y448C probably damaging Het
Plppr4 A T 3: 117,116,866 (GRCm39) N330K probably damaging Het
Pou2f2 A G 7: 24,794,247 (GRCm39) L373S probably benign Het
Rnpep A G 1: 135,211,341 (GRCm39) F136L probably benign Het
Rp1 A G 1: 4,162,838 (GRCm39) probably null Het
Shank1 G A 7: 43,962,342 (GRCm39) S71N unknown Het
Slc5a4a GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC 10: 75,986,238 (GRCm39) probably benign Het
Slc5a5 T C 8: 71,337,596 (GRCm39) D574G probably benign Het
Slc7a15 T A 12: 8,588,794 (GRCm39) N251I probably damaging Het
Speer4a3 A T 5: 26,158,136 (GRCm39) I72N probably damaging Het
Susd4 T C 1: 182,719,665 (GRCm39) S427P probably benign Het
Tarbp1 T A 8: 127,155,779 (GRCm39) T1320S probably benign Het
Tbpl2 C T 2: 23,984,650 (GRCm39) V166I probably benign Het
Thbs1 T C 2: 117,950,518 (GRCm39) probably null Het
Tnfsf13b A G 8: 10,081,648 (GRCm39) Y270C probably damaging Het
Vps11 G T 9: 44,260,290 (GRCm39) C857* probably null Het
Vsig10 G A 5: 117,463,104 (GRCm39) R110H probably benign Het
Wee2 T A 6: 40,432,044 (GRCm39) Y204* probably null Het
Zfpm2 T A 15: 40,966,867 (GRCm39) S1117R probably damaging Het
Zscan5b A G 7: 6,234,472 (GRCm39) N166S probably benign Het
Other mutations in Lrrc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Lrrc7 APN 3 157,892,647 (GRCm39) missense probably benign 0.07
IGL00644:Lrrc7 APN 3 157,908,005 (GRCm39) nonsense probably null
IGL00822:Lrrc7 APN 3 157,891,111 (GRCm39) missense probably damaging 0.99
IGL00927:Lrrc7 APN 3 157,866,727 (GRCm39) missense possibly damaging 0.94
IGL00946:Lrrc7 APN 3 157,866,993 (GRCm39) missense probably benign 0.07
IGL00948:Lrrc7 APN 3 157,867,194 (GRCm39) missense probably damaging 1.00
IGL01838:Lrrc7 APN 3 157,891,100 (GRCm39) missense probably damaging 1.00
IGL01874:Lrrc7 APN 3 157,946,080 (GRCm39) splice site probably benign
IGL02514:Lrrc7 APN 3 157,865,929 (GRCm39) missense probably damaging 0.96
IGL02545:Lrrc7 APN 3 157,891,011 (GRCm39) splice site probably benign
IGL02665:Lrrc7 APN 3 157,866,742 (GRCm39) missense probably damaging 0.99
IGL03129:Lrrc7 APN 3 157,866,696 (GRCm39) missense probably benign 0.02
N/A:Lrrc7 UTSW 3 157,865,977 (GRCm39) missense probably benign
R0021:Lrrc7 UTSW 3 157,866,298 (GRCm39) missense probably damaging 1.00
R0041:Lrrc7 UTSW 3 157,869,897 (GRCm39) splice site probably benign
R0255:Lrrc7 UTSW 3 157,866,475 (GRCm39) nonsense probably null
R0278:Lrrc7 UTSW 3 157,885,432 (GRCm39) missense possibly damaging 0.96
R0409:Lrrc7 UTSW 3 157,867,063 (GRCm39) missense possibly damaging 0.59
R0612:Lrrc7 UTSW 3 157,869,990 (GRCm39) missense probably damaging 0.98
R0866:Lrrc7 UTSW 3 157,869,903 (GRCm39) splice site probably benign
R1077:Lrrc7 UTSW 3 157,866,780 (GRCm39) missense probably damaging 1.00
R1103:Lrrc7 UTSW 3 157,854,343 (GRCm39) splice site probably benign
R1157:Lrrc7 UTSW 3 157,865,892 (GRCm39) missense probably damaging 1.00
R1187:Lrrc7 UTSW 3 157,866,039 (GRCm39) missense probably damaging 1.00
R1301:Lrrc7 UTSW 3 157,840,968 (GRCm39) missense probably benign 0.20
R1433:Lrrc7 UTSW 3 157,882,943 (GRCm39) missense probably damaging 1.00
R1450:Lrrc7 UTSW 3 157,892,681 (GRCm39) missense possibly damaging 0.62
R1595:Lrrc7 UTSW 3 157,882,914 (GRCm39) nonsense probably null
R1659:Lrrc7 UTSW 3 157,867,045 (GRCm39) missense probably damaging 1.00
R1693:Lrrc7 UTSW 3 157,790,170 (GRCm39) missense possibly damaging 0.95
R1774:Lrrc7 UTSW 3 157,865,929 (GRCm39) missense possibly damaging 0.88
R2273:Lrrc7 UTSW 3 157,892,696 (GRCm39) missense probably damaging 1.00
R2276:Lrrc7 UTSW 3 157,885,429 (GRCm39) missense probably damaging 1.00
R2302:Lrrc7 UTSW 3 157,840,881 (GRCm39) missense probably damaging 0.99
R2326:Lrrc7 UTSW 3 157,876,298 (GRCm39) missense probably damaging 1.00
R2371:Lrrc7 UTSW 3 157,866,697 (GRCm39) missense probably damaging 0.99
R2383:Lrrc7 UTSW 3 157,869,593 (GRCm39) missense probably benign
R2679:Lrrc7 UTSW 3 157,880,745 (GRCm39) nonsense probably null
R2698:Lrrc7 UTSW 3 157,841,028 (GRCm39) missense probably benign 0.22
R2858:Lrrc7 UTSW 3 157,867,362 (GRCm39) missense probably damaging 0.99
R3758:Lrrc7 UTSW 3 157,869,602 (GRCm39) missense probably damaging 1.00
R3791:Lrrc7 UTSW 3 157,869,593 (GRCm39) missense probably benign
R3805:Lrrc7 UTSW 3 157,891,130 (GRCm39) missense probably benign 0.10
R3806:Lrrc7 UTSW 3 157,891,130 (GRCm39) missense probably benign 0.10
R3807:Lrrc7 UTSW 3 157,891,130 (GRCm39) missense probably benign 0.10
R3892:Lrrc7 UTSW 3 157,866,333 (GRCm39) missense probably benign 0.08
R3912:Lrrc7 UTSW 3 157,997,589 (GRCm39) missense probably damaging 1.00
R3913:Lrrc7 UTSW 3 157,997,589 (GRCm39) missense probably damaging 1.00
R3963:Lrrc7 UTSW 3 157,866,042 (GRCm39) missense probably damaging 1.00
R4665:Lrrc7 UTSW 3 158,024,045 (GRCm39) critical splice donor site probably benign
R4666:Lrrc7 UTSW 3 158,024,045 (GRCm39) critical splice donor site probably benign
R4671:Lrrc7 UTSW 3 157,908,132 (GRCm39) critical splice acceptor site probably null
R4688:Lrrc7 UTSW 3 157,854,242 (GRCm39) missense probably damaging 1.00
R4725:Lrrc7 UTSW 3 158,024,045 (GRCm39) critical splice donor site probably benign
R4726:Lrrc7 UTSW 3 158,024,045 (GRCm39) critical splice donor site probably benign
R4728:Lrrc7 UTSW 3 158,024,045 (GRCm39) critical splice donor site probably benign
R4783:Lrrc7 UTSW 3 157,832,850 (GRCm39) critical splice donor site probably null
R4867:Lrrc7 UTSW 3 157,866,642 (GRCm39) missense probably damaging 1.00
R4907:Lrrc7 UTSW 3 157,866,877 (GRCm39) missense probably damaging 1.00
R5032:Lrrc7 UTSW 3 157,887,217 (GRCm39) missense possibly damaging 0.85
R5107:Lrrc7 UTSW 3 157,867,533 (GRCm39) missense probably damaging 1.00
R5295:Lrrc7 UTSW 3 157,876,376 (GRCm39) missense probably damaging 1.00
R5348:Lrrc7 UTSW 3 157,880,963 (GRCm39) missense probably benign 0.02
R5468:Lrrc7 UTSW 3 158,024,073 (GRCm39) missense probably damaging 1.00
R5778:Lrrc7 UTSW 3 157,876,380 (GRCm39) missense probably damaging 1.00
R5897:Lrrc7 UTSW 3 157,869,990 (GRCm39) missense probably damaging 0.98
R6179:Lrrc7 UTSW 3 158,059,069 (GRCm39) missense probably damaging 0.99
R6312:Lrrc7 UTSW 3 157,866,246 (GRCm39) missense probably benign 0.04
R6313:Lrrc7 UTSW 3 157,866,373 (GRCm39) missense probably damaging 1.00
R6366:Lrrc7 UTSW 3 157,841,012 (GRCm39) missense probably benign 0.04
R6389:Lrrc7 UTSW 3 157,891,063 (GRCm39) missense probably damaging 1.00
R6638:Lrrc7 UTSW 3 157,840,940 (GRCm39) missense probably benign 0.20
R6956:Lrrc7 UTSW 3 157,994,668 (GRCm39) missense probably benign 0.02
R6969:Lrrc7 UTSW 3 157,862,550 (GRCm39) missense probably benign 0.19
R7073:Lrrc7 UTSW 3 157,832,884 (GRCm39) missense probably damaging 1.00
R7313:Lrrc7 UTSW 3 157,866,111 (GRCm39) missense probably damaging 1.00
R7365:Lrrc7 UTSW 3 157,903,798 (GRCm39) missense probably damaging 1.00
R7398:Lrrc7 UTSW 3 157,997,595 (GRCm39) nonsense probably null
R7403:Lrrc7 UTSW 3 157,854,311 (GRCm39) nonsense probably null
R7407:Lrrc7 UTSW 3 157,840,878 (GRCm39) missense probably damaging 1.00
R7427:Lrrc7 UTSW 3 157,903,778 (GRCm39) missense probably benign 0.06
R7453:Lrrc7 UTSW 3 157,891,046 (GRCm39) missense probably benign 0.00
R7461:Lrrc7 UTSW 3 157,892,657 (GRCm39) missense probably benign 0.00
R7807:Lrrc7 UTSW 3 157,866,124 (GRCm39) missense probably damaging 1.00
R7872:Lrrc7 UTSW 3 158,059,099 (GRCm39) missense probably damaging 0.99
R8215:Lrrc7 UTSW 3 157,915,387 (GRCm39) missense probably benign
R8367:Lrrc7 UTSW 3 157,908,007 (GRCm39) missense possibly damaging 0.80
R8867:Lrrc7 UTSW 3 157,867,521 (GRCm39) missense probably damaging 0.99
R8880:Lrrc7 UTSW 3 157,867,381 (GRCm39) missense probably damaging 0.99
R8941:Lrrc7 UTSW 3 157,869,593 (GRCm39) missense probably benign
R8958:Lrrc7 UTSW 3 157,946,138 (GRCm39) missense probably benign 0.02
R9068:Lrrc7 UTSW 3 157,946,138 (GRCm39) missense probably benign 0.02
R9069:Lrrc7 UTSW 3 157,946,138 (GRCm39) missense probably benign 0.02
R9180:Lrrc7 UTSW 3 157,867,011 (GRCm39) missense possibly damaging 0.61
R9193:Lrrc7 UTSW 3 158,059,011 (GRCm39) nonsense probably null
R9309:Lrrc7 UTSW 3 157,915,361 (GRCm39) nonsense probably null
R9418:Lrrc7 UTSW 3 157,908,023 (GRCm39) missense possibly damaging 0.66
R9515:Lrrc7 UTSW 3 157,867,105 (GRCm39) missense probably damaging 1.00
R9635:Lrrc7 UTSW 3 157,946,138 (GRCm39) missense probably benign 0.02
R9639:Lrrc7 UTSW 3 157,946,138 (GRCm39) missense probably benign 0.02
R9682:Lrrc7 UTSW 3 157,882,954 (GRCm39) missense possibly damaging 0.92
R9731:Lrrc7 UTSW 3 157,880,888 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AACCGTCCATACTCCTCTGC -3'
(R):5'- AGGTACCAGTACAAACATCTCC -3'

Sequencing Primer
(F):5'- GCCCTTTCGTTTGAATTAAGCAC -3'
(R):5'- GGTACCAGTACAAACATCTCCACCAG -3'
Posted On 2022-06-15