Incidental Mutation 'R9474:Emc1'
ID 715619
Institutional Source Beutler Lab
Gene Symbol Emc1
Ensembl Gene ENSMUSG00000078517
Gene Name ER membrane protein complex subunit 1
Synonyms C230096C10Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock # R9474 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 139352587-139378730 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 139366394 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 605 (L605Q)
Ref Sequence ENSEMBL: ENSMUSP00000080888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042096] [ENSMUST00000082262] [ENSMUST00000147999] [ENSMUST00000155700] [ENSMUST00000179784]
AlphaFold Q8C7X2
Predicted Effect probably damaging
Transcript: ENSMUST00000042096
AA Change: L602Q

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000049034
Gene: ENSMUSG00000078517
AA Change: L602Q

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 787 993 1.1e-66 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000082262
AA Change: L605Q

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000080888
Gene: ENSMUSG00000078517
AA Change: L605Q

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 4.7e-10 PFAM
Pfam:DUF1620 791 996 1.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147999
SMART Domains Protein: ENSMUSP00000117419
Gene: ENSMUSG00000066036

DomainStartEndE-ValueType
low complexity region 170 226 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Pfam:E3_UbLigase_R4 1205 1301 4.5e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155700
Predicted Effect possibly damaging
Transcript: ENSMUST00000179784
AA Change: L605Q

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137103
Gene: ENSMUSG00000078517
AA Change: L605Q

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 790 996 1.1e-66 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type I transmembrane protein, which is a subunit of the endoplasmic reticulum membrane protein complex (EMC). Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik C A 10: 79,067,731 K250N probably damaging Het
9530077C05Rik T C 9: 22,431,719 M303T probably damaging Het
Adam5 A T 8: 24,747,524 D623E possibly damaging Het
Akt3 T C 1: 177,025,386 Y473C probably damaging Het
Ankib1 A G 5: 3,755,617 Y217H probably damaging Het
Clca4b T A 3: 144,911,166 T908S probably benign Het
Clec7a G A 6: 129,463,163 Q160* probably null Het
Cntnap4 T A 8: 112,733,471 I152N probably damaging Het
Ctdspl C T 9: 119,037,377 A179V probably damaging Het
Ddx43 T C 9: 78,406,386 S200P probably damaging Het
Dip2c A G 13: 9,494,927 D84G unknown Het
Dmbt1 G A 7: 131,074,257 R625H unknown Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
E2f7 C T 10: 110,767,189 T355I probably damaging Het
E2f7 C A 10: 110,779,057 L541M probably damaging Het
Elovl5 T A 9: 77,982,725 S273T possibly damaging Het
Fras1 T A 5: 96,739,265 D2635E probably benign Het
Gabrb1 G A 5: 72,108,347 G195E probably damaging Het
Galm A G 17: 80,150,132 D199G possibly damaging Het
Galntl6 T G 8: 57,777,325 S20R probably damaging Het
Gm21671 A T 5: 25,953,138 I72N probably damaging Het
Grb14 T G 2: 64,938,400 Y189S probably damaging Het
Hk2 T A 6: 82,728,914 I803F probably damaging Het
Hmcn1 G A 1: 150,630,720 R3779W probably damaging Het
Hmgcr A C 13: 96,659,895 M260R probably damaging Het
Hsbp1l1 T A 18: 80,233,424 K68N possibly damaging Het
Inhba A C 13: 16,017,678 E128A probably benign Het
Itpr3 G A 17: 27,118,677 probably benign Het
Klhl3 G A 13: 58,019,459 P364S probably damaging Het
Lhpp T C 7: 132,641,583 L176P probably damaging Het
Lrp1b C A 2: 40,601,587 A223S probably damaging Het
Lrp3 A G 7: 35,204,064 F286L probably damaging Het
Lrrc7 T C 3: 158,135,391 T1337A probably benign Het
Magi2 A G 5: 20,195,021 D17G probably benign Het
Map3k21 T C 8: 125,924,164 S302P probably damaging Het
Mbtd1 A G 11: 93,925,685 D386G probably benign Het
Mfsd2b A T 12: 4,866,820 D306E possibly damaging Het
Muc20 T C 16: 32,794,083 E308G probably damaging Het
Myh13 G A 11: 67,364,886 S34N Het
Nebl C A 2: 17,369,610 G894* probably null Het
Nelfa A G 5: 33,898,751 Y523H probably damaging Het
Ninj1 A G 13: 49,187,600 D13G probably benign Het
Ninl A T 2: 150,940,806 S170T probably benign Het
Nlrp4c G A 7: 6,065,627 V176M possibly damaging Het
Nobox G A 6: 43,307,181 R144C probably damaging Het
Oas1a G A 5: 120,899,254 L237F probably damaging Het
Olfr1099 A G 2: 86,959,413 M15T probably benign Het
Olfr1153 T C 2: 87,896,349 M50T probably benign Het
Olfr1254 A C 2: 89,789,162 Y63* probably null Het
Olfr1348 A G 7: 6,502,151 L25P probably benign Het
Olfr1356 T C 10: 78,847,057 N286S probably damaging Het
Olfr625-ps1 A T 7: 103,683,270 Y184F probably damaging Het
Orai1 A G 5: 123,029,238 N158S probably damaging Het
Pa2g4 C A 10: 128,563,098 V121L probably benign Het
Pclo T C 5: 14,521,236 S212P possibly damaging Het
Plce1 G A 19: 38,777,893 E2121K possibly damaging Het
Plg A G 17: 12,403,137 Y448C probably damaging Het
Plppr4 A T 3: 117,323,217 N330K probably damaging Het
Pou2f2 A G 7: 25,094,822 L373S probably benign Het
Rnpep A G 1: 135,283,603 F136L probably benign Het
Rp1 A G 1: 4,092,615 probably null Het
Shank1 G A 7: 44,312,918 S71N unknown Het
Slc5a4a GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC 10: 76,150,404 probably benign Het
Slc5a5 T C 8: 70,884,952 D574G probably benign Het
Slc7a15 T A 12: 8,538,794 N251I probably damaging Het
Susd4 T C 1: 182,892,100 S427P probably benign Het
Tarbp1 T A 8: 126,429,040 T1320S probably benign Het
Tbpl2 C T 2: 24,094,638 V166I probably benign Het
Thbs1 T C 2: 118,120,037 probably null Het
Tnfsf13b A G 8: 10,031,648 Y270C probably damaging Het
Vps11 G T 9: 44,348,993 C857* probably null Het
Vsig10 G A 5: 117,325,039 R110H probably benign Het
Wee2 T A 6: 40,455,110 Y204* probably null Het
Zfpm2 T A 15: 41,103,471 S1117R probably damaging Het
Zscan5b A G 7: 6,231,473 N166S probably benign Het
Other mutations in Emc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Emc1 APN 4 139355082 splice site probably benign
IGL00898:Emc1 APN 4 139371630 missense probably damaging 1.00
IGL01481:Emc1 APN 4 139362099 missense probably benign 0.00
IGL02174:Emc1 APN 4 139371668 missense possibly damaging 0.95
IGL02264:Emc1 APN 4 139375464 missense probably damaging 1.00
IGL02501:Emc1 APN 4 139370984 missense probably benign 0.00
IGL02697:Emc1 APN 4 139352644 missense probably benign
IGL03355:Emc1 APN 4 139371593 splice site probably benign
IGL03386:Emc1 APN 4 139363781 critical splice donor site probably null
PIT4480001:Emc1 UTSW 4 139359277 missense possibly damaging 0.69
R0023:Emc1 UTSW 4 139371009 missense probably damaging 1.00
R0023:Emc1 UTSW 4 139371009 missense probably damaging 1.00
R0051:Emc1 UTSW 4 139375163 missense possibly damaging 0.81
R0094:Emc1 UTSW 4 139360485 missense probably damaging 0.99
R0613:Emc1 UTSW 4 139375072 splice site probably benign
R1464:Emc1 UTSW 4 139370937 missense probably damaging 0.97
R1464:Emc1 UTSW 4 139370937 missense probably damaging 0.97
R1512:Emc1 UTSW 4 139360184 splice site probably null
R1702:Emc1 UTSW 4 139375201 missense probably damaging 1.00
R1839:Emc1 UTSW 4 139360485 missense probably damaging 0.98
R1843:Emc1 UTSW 4 139375512 missense probably benign 0.02
R1850:Emc1 UTSW 4 139359373 splice site probably benign
R2024:Emc1 UTSW 4 139360946 missense possibly damaging 0.95
R2196:Emc1 UTSW 4 139366530 missense probably benign 0.08
R2912:Emc1 UTSW 4 139365260 missense possibly damaging 0.51
R3696:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3697:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3698:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3803:Emc1 UTSW 4 139367163 missense possibly damaging 0.91
R3923:Emc1 UTSW 4 139363185 nonsense probably null
R4738:Emc1 UTSW 4 139362202 missense possibly damaging 0.52
R4914:Emc1 UTSW 4 139375165 nonsense probably null
R5033:Emc1 UTSW 4 139371696 missense probably damaging 1.00
R5322:Emc1 UTSW 4 139354246 missense probably damaging 1.00
R5375:Emc1 UTSW 4 139366491 missense probably damaging 0.96
R5483:Emc1 UTSW 4 139375376 missense probably damaging 1.00
R5587:Emc1 UTSW 4 139362148 missense probably damaging 0.98
R5687:Emc1 UTSW 4 139375380 missense probably damaging 1.00
R5938:Emc1 UTSW 4 139357620 missense probably benign
R6056:Emc1 UTSW 4 139354222 missense possibly damaging 0.51
R6170:Emc1 UTSW 4 139366378 missense probably benign 0.01
R6174:Emc1 UTSW 4 139366531 missense probably benign 0.01
R6208:Emc1 UTSW 4 139354271 missense probably damaging 0.99
R6340:Emc1 UTSW 4 139365563 missense probably damaging 1.00
R6371:Emc1 UTSW 4 139371665 nonsense probably null
R6889:Emc1 UTSW 4 139365350 missense probably damaging 0.97
R7592:Emc1 UTSW 4 139360566 missense probably benign 0.00
R7699:Emc1 UTSW 4 139354870 missense probably benign
R7715:Emc1 UTSW 4 139371623 missense probably damaging 1.00
R7984:Emc1 UTSW 4 139375449 missense probably damaging 1.00
R8112:Emc1 UTSW 4 139367187 missense probably benign 0.00
R8325:Emc1 UTSW 4 139365210 missense possibly damaging 0.94
R8387:Emc1 UTSW 4 139361289 missense probably benign
R8751:Emc1 UTSW 4 139369968 missense possibly damaging 0.58
R9032:Emc1 UTSW 4 139367163 missense possibly damaging 0.91
R9085:Emc1 UTSW 4 139367163 missense possibly damaging 0.91
R9482:Emc1 UTSW 4 139360890 missense probably damaging 0.96
R9610:Emc1 UTSW 4 139363724 missense probably benign 0.38
R9611:Emc1 UTSW 4 139363724 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- AAGCAGTCCCATCAGCCTAG -3'
(R):5'- ACAACAAACGGGCTGTCTG -3'

Sequencing Primer
(F):5'- TCCCATCAGCCTAGGGGAC -3'
(R):5'- CAACAAACGGGCTGTCTGGTATG -3'
Posted On 2022-06-15