Incidental Mutation 'R9474:Magi2'
ID 715622
Institutional Source Beutler Lab
Gene Symbol Magi2
Ensembl Gene ENSMUSG00000040003
Gene Name membrane associated guanylate kinase, WW and PDZ domain containing 2
Synonyms Acvrinp1, Magi-2, S-SCAM
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9474 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 19432034-20909790 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 20400019 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 17 (D17G)
Ref Sequence ENSEMBL: ENSMUSP00000099094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088516] [ENSMUST00000101558] [ENSMUST00000115267] [ENSMUST00000197354] [ENSMUST00000197443] [ENSMUST00000200443]
AlphaFold Q9WVQ1
Predicted Effect probably benign
Transcript: ENSMUST00000088516
AA Change: D180G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000085872
Gene: ENSMUSG00000040003
AA Change: D180G

DomainStartEndE-ValueType
PDZ 26 101 5.26e-9 SMART
GuKc 107 290 2.76e-45 SMART
WW 302 334 7.43e-12 SMART
WW 348 380 2.4e-6 SMART
PDZ 433 509 3.51e-19 SMART
PDZ 612 682 2.3e-14 SMART
PDZ 785 861 4.04e-19 SMART
low complexity region 893 907 N/A INTRINSIC
PDZ 928 1009 5.05e-20 SMART
low complexity region 1052 1063 N/A INTRINSIC
PDZ 1147 1221 3.88e-21 SMART
low complexity region 1257 1270 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101558
AA Change: D17G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000099094
Gene: ENSMUSG00000040003
AA Change: D17G

DomainStartEndE-ValueType
low complexity region 66 74 N/A INTRINSIC
WW 139 171 7.43e-12 SMART
WW 185 217 2.4e-6 SMART
PDZ 270 346 3.51e-19 SMART
PDZ 449 519 2.3e-14 SMART
PDZ 608 684 4.04e-19 SMART
low complexity region 716 730 N/A INTRINSIC
PDZ 751 832 5.05e-20 SMART
low complexity region 875 886 N/A INTRINSIC
PDZ 970 1044 3.88e-21 SMART
low complexity region 1080 1093 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115267
AA Change: D17G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110922
Gene: ENSMUSG00000040003
AA Change: D17G

DomainStartEndE-ValueType
low complexity region 66 74 N/A INTRINSIC
WW 139 171 7.43e-12 SMART
WW 185 217 2.4e-6 SMART
PDZ 270 346 3.51e-19 SMART
PDZ 449 519 2.3e-14 SMART
PDZ 622 698 4.04e-19 SMART
low complexity region 730 744 N/A INTRINSIC
PDZ 765 846 5.05e-20 SMART
low complexity region 889 900 N/A INTRINSIC
PDZ 984 1058 3.88e-21 SMART
low complexity region 1094 1107 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000197354
AA Change: D180G

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000142576
Gene: ENSMUSG00000040003
AA Change: D180G

DomainStartEndE-ValueType
PDZ 26 101 2.5e-11 SMART
GuKc 107 290 1.4e-47 SMART
WW 302 334 4.3e-14 SMART
WW 348 380 1.4e-8 SMART
PDZ 433 509 1.7e-21 SMART
PDZ 612 682 1.1e-16 SMART
PDZ 785 861 2e-21 SMART
low complexity region 893 907 N/A INTRINSIC
PDZ 928 1009 2.4e-22 SMART
low complexity region 1052 1063 N/A INTRINSIC
PDZ 1147 1221 1.9e-23 SMART
low complexity region 1255 1269 N/A INTRINSIC
low complexity region 1304 1319 N/A INTRINSIC
low complexity region 1344 1363 N/A INTRINSIC
low complexity region 1368 1384 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197443
AA Change: D180G

PolyPhen 2 Score 0.257 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000142764
Gene: ENSMUSG00000040003
AA Change: D180G

DomainStartEndE-ValueType
PDZ 26 101 2.5e-11 SMART
GuKc 107 290 1.4e-47 SMART
WW 302 334 4.3e-14 SMART
WW 348 380 1.4e-8 SMART
PDZ 433 509 1.7e-21 SMART
PDZ 612 682 1.1e-16 SMART
PDZ 771 847 2e-21 SMART
low complexity region 879 893 N/A INTRINSIC
PDZ 914 995 2.4e-22 SMART
low complexity region 1038 1049 N/A INTRINSIC
PDZ 1133 1207 1.9e-23 SMART
low complexity region 1241 1255 N/A INTRINSIC
low complexity region 1290 1305 N/A INTRINSIC
low complexity region 1330 1349 N/A INTRINSIC
low complexity region 1354 1370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200443
AA Change: D17G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with atrophin-1. Atrophin-1 contains a polyglutamine repeat, expansion of which is responsible for dentatorubral and pallidoluysian atrophy. This encoded protein is characterized by two WW domains, a guanylate kinase-like domain, and multiple PDZ domains. It has structural similarity to the membrane-associated guanylate kinase homologue (MAGUK) family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show neonatal death and hippocampal neurons with altered dendritic spine morphology. Homozygotes for a different null allele die neonatally due to anuria and podocyte anomalies. Mice lacking all three isoforms develop proteinuria, podocytopathy and die of renal failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik C A 10: 78,903,565 (GRCm39) K250N probably damaging Het
Adam5 A T 8: 25,237,540 (GRCm39) D623E possibly damaging Het
Akt3 T C 1: 176,852,952 (GRCm39) Y473C probably damaging Het
Ankib1 A G 5: 3,805,617 (GRCm39) Y217H probably damaging Het
Clca4b T A 3: 144,616,927 (GRCm39) T908S probably benign Het
Clec7a G A 6: 129,440,126 (GRCm39) Q160* probably null Het
Cntnap4 T A 8: 113,460,103 (GRCm39) I152N probably damaging Het
Ctdspl C T 9: 118,866,445 (GRCm39) A179V probably damaging Het
Ddx43 T C 9: 78,313,668 (GRCm39) S200P probably damaging Het
Dip2c A G 13: 9,544,963 (GRCm39) D84G unknown Het
Dmbt1 G A 7: 130,675,987 (GRCm39) R625H unknown Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 72,684,217 (GRCm39) probably benign Het
E2f7 C T 10: 110,603,050 (GRCm39) T355I probably damaging Het
E2f7 C A 10: 110,614,918 (GRCm39) L541M probably damaging Het
Elovl5 T A 9: 77,890,007 (GRCm39) S273T possibly damaging Het
Emc1 T A 4: 139,093,705 (GRCm39) L605Q probably damaging Het
Fras1 T A 5: 96,887,124 (GRCm39) D2635E probably benign Het
Gabrb1 G A 5: 72,265,690 (GRCm39) G195E probably damaging Het
Galm A G 17: 80,457,561 (GRCm39) D199G possibly damaging Het
Galntl6 T G 8: 58,230,359 (GRCm39) S20R probably damaging Het
Grb14 T G 2: 64,768,744 (GRCm39) Y189S probably damaging Het
Hk2 T A 6: 82,705,895 (GRCm39) I803F probably damaging Het
Hmcn1 G A 1: 150,506,471 (GRCm39) R3779W probably damaging Het
Hmgcr A C 13: 96,796,403 (GRCm39) M260R probably damaging Het
Hsbp1l1 T A 18: 80,276,639 (GRCm39) K68N possibly damaging Het
Inhba A C 13: 16,192,263 (GRCm39) E128A probably benign Het
Itpr3 G A 17: 27,337,651 (GRCm39) probably benign Het
Klhl3 G A 13: 58,167,273 (GRCm39) P364S probably damaging Het
Lhpp T C 7: 132,243,312 (GRCm39) L176P probably damaging Het
Lrp1b C A 2: 40,491,599 (GRCm39) A223S probably damaging Het
Lrp3 A G 7: 34,903,489 (GRCm39) F286L probably damaging Het
Lrrc7 T C 3: 157,841,028 (GRCm39) T1337A probably benign Het
Map3k21 T C 8: 126,650,903 (GRCm39) S302P probably damaging Het
Matcap2 T C 9: 22,343,015 (GRCm39) M303T probably damaging Het
Mbtd1 A G 11: 93,816,511 (GRCm39) D386G probably benign Het
Mfsd2b A T 12: 4,916,820 (GRCm39) D306E possibly damaging Het
Muc20 T C 16: 32,614,453 (GRCm39) E308G probably damaging Het
Myh13 G A 11: 67,255,712 (GRCm39) S34N Het
Nebl C A 2: 17,374,421 (GRCm39) G894* probably null Het
Nelfa A G 5: 34,056,095 (GRCm39) Y523H probably damaging Het
Ninj1 A G 13: 49,341,076 (GRCm39) D13G probably benign Het
Ninl A T 2: 150,782,726 (GRCm39) S170T probably benign Het
Nlrp4c G A 7: 6,068,626 (GRCm39) V176M possibly damaging Het
Nobox G A 6: 43,284,115 (GRCm39) R144C probably damaging Het
Oas1a G A 5: 121,037,317 (GRCm39) L237F probably damaging Het
Or4a81 A C 2: 89,619,506 (GRCm39) Y63* probably null Het
Or52z15 A T 7: 103,332,477 (GRCm39) Y184F probably damaging Het
Or5w20 T C 2: 87,726,693 (GRCm39) M50T probably benign Het
Or6z1 A G 7: 6,505,150 (GRCm39) L25P probably benign Het
Or7c70 T C 10: 78,682,891 (GRCm39) N286S probably damaging Het
Or8h9 A G 2: 86,789,757 (GRCm39) M15T probably benign Het
Orai1 A G 5: 123,167,301 (GRCm39) N158S probably damaging Het
Pa2g4 C A 10: 128,398,967 (GRCm39) V121L probably benign Het
Pclo T C 5: 14,571,250 (GRCm39) S212P possibly damaging Het
Plce1 G A 19: 38,766,337 (GRCm39) E2121K possibly damaging Het
Plg A G 17: 12,622,024 (GRCm39) Y448C probably damaging Het
Plppr4 A T 3: 117,116,866 (GRCm39) N330K probably damaging Het
Pou2f2 A G 7: 24,794,247 (GRCm39) L373S probably benign Het
Rnpep A G 1: 135,211,341 (GRCm39) F136L probably benign Het
Rp1 A G 1: 4,162,838 (GRCm39) probably null Het
Shank1 G A 7: 43,962,342 (GRCm39) S71N unknown Het
Slc5a4a GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC 10: 75,986,238 (GRCm39) probably benign Het
Slc5a5 T C 8: 71,337,596 (GRCm39) D574G probably benign Het
Slc7a15 T A 12: 8,588,794 (GRCm39) N251I probably damaging Het
Speer4a3 A T 5: 26,158,136 (GRCm39) I72N probably damaging Het
Susd4 T C 1: 182,719,665 (GRCm39) S427P probably benign Het
Tarbp1 T A 8: 127,155,779 (GRCm39) T1320S probably benign Het
Tbpl2 C T 2: 23,984,650 (GRCm39) V166I probably benign Het
Thbs1 T C 2: 117,950,518 (GRCm39) probably null Het
Tnfsf13b A G 8: 10,081,648 (GRCm39) Y270C probably damaging Het
Vps11 G T 9: 44,260,290 (GRCm39) C857* probably null Het
Vsig10 G A 5: 117,463,104 (GRCm39) R110H probably benign Het
Wee2 T A 6: 40,432,044 (GRCm39) Y204* probably null Het
Zfpm2 T A 15: 40,966,867 (GRCm39) S1117R probably damaging Het
Zscan5b A G 7: 6,234,472 (GRCm39) N166S probably benign Het
Other mutations in Magi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00908:Magi2 APN 5 20,596,299 (GRCm39) missense probably benign 0.05
IGL02120:Magi2 APN 5 20,433,451 (GRCm39) critical splice donor site probably null
IGL02341:Magi2 APN 5 20,671,201 (GRCm39) missense probably damaging 1.00
IGL02411:Magi2 APN 5 19,883,707 (GRCm39) missense probably damaging 1.00
IGL02657:Magi2 APN 5 19,432,581 (GRCm39) missense probably damaging 0.99
IGL02976:Magi2 APN 5 20,739,473 (GRCm39) missense probably damaging 1.00
IGL03105:Magi2 APN 5 20,748,616 (GRCm39) missense probably damaging 0.97
IGL03246:Magi2 APN 5 20,563,948 (GRCm39) missense probably damaging 1.00
IGL03329:Magi2 APN 5 20,671,126 (GRCm39) missense possibly damaging 0.95
LCD18:Magi2 UTSW 5 20,159,509 (GRCm39) intron probably benign
PIT4519001:Magi2 UTSW 5 20,866,344 (GRCm39) missense probably damaging 1.00
R0009:Magi2 UTSW 5 20,816,053 (GRCm39) missense probably benign 0.15
R0009:Magi2 UTSW 5 20,816,053 (GRCm39) missense probably benign 0.15
R0352:Magi2 UTSW 5 20,270,664 (GRCm39) missense probably damaging 1.00
R0362:Magi2 UTSW 5 19,432,573 (GRCm39) missense probably damaging 1.00
R0496:Magi2 UTSW 5 20,866,357 (GRCm39) splice site probably benign
R1103:Magi2 UTSW 5 20,816,101 (GRCm39) missense probably damaging 1.00
R1435:Magi2 UTSW 5 20,563,943 (GRCm39) missense probably damaging 1.00
R1583:Magi2 UTSW 5 19,432,330 (GRCm39) missense probably benign 0.30
R1616:Magi2 UTSW 5 20,814,324 (GRCm39) missense probably damaging 1.00
R1643:Magi2 UTSW 5 20,910,504 (GRCm39) unclassified probably benign
R1707:Magi2 UTSW 5 20,420,491 (GRCm39) missense probably damaging 1.00
R1833:Magi2 UTSW 5 19,432,455 (GRCm39) missense probably damaging 1.00
R1837:Magi2 UTSW 5 20,670,825 (GRCm39) missense probably damaging 1.00
R1838:Magi2 UTSW 5 20,670,825 (GRCm39) missense probably damaging 1.00
R1839:Magi2 UTSW 5 20,670,825 (GRCm39) missense probably damaging 1.00
R1847:Magi2 UTSW 5 20,807,458 (GRCm39) missense probably damaging 0.99
R2223:Magi2 UTSW 5 20,670,670 (GRCm39) missense probably damaging 1.00
R2496:Magi2 UTSW 5 19,883,750 (GRCm39) missense probably benign 0.42
R2504:Magi2 UTSW 5 20,563,934 (GRCm39) missense probably damaging 1.00
R2848:Magi2 UTSW 5 20,807,459 (GRCm39) frame shift probably null
R2879:Magi2 UTSW 5 20,807,459 (GRCm39) frame shift probably null
R2935:Magi2 UTSW 5 20,807,459 (GRCm39) frame shift probably null
R2936:Magi2 UTSW 5 20,807,459 (GRCm39) frame shift probably null
R3694:Magi2 UTSW 5 20,807,459 (GRCm39) frame shift probably null
R3783:Magi2 UTSW 5 20,670,907 (GRCm39) missense probably damaging 0.97
R3786:Magi2 UTSW 5 20,670,907 (GRCm39) missense probably damaging 0.97
R3787:Magi2 UTSW 5 20,670,907 (GRCm39) missense probably damaging 0.97
R3837:Magi2 UTSW 5 20,420,466 (GRCm39) missense probably benign 0.28
R4151:Magi2 UTSW 5 19,432,290 (GRCm39) missense probably damaging 0.97
R4721:Magi2 UTSW 5 20,739,467 (GRCm39) missense probably damaging 1.00
R5005:Magi2 UTSW 5 20,739,444 (GRCm39) missense probably damaging 0.98
R5012:Magi2 UTSW 5 20,670,618 (GRCm39) missense probably damaging 0.99
R5193:Magi2 UTSW 5 20,563,970 (GRCm39) critical splice donor site probably null
R5298:Magi2 UTSW 5 20,774,160 (GRCm39) missense probably damaging 1.00
R5372:Magi2 UTSW 5 20,907,108 (GRCm39) missense possibly damaging 0.82
R5580:Magi2 UTSW 5 20,420,422 (GRCm39) missense probably benign 0.03
R5806:Magi2 UTSW 5 20,856,202 (GRCm39) missense probably benign 0.01
R5924:Magi2 UTSW 5 20,816,067 (GRCm39) missense probably benign 0.00
R5992:Magi2 UTSW 5 19,432,289 (GRCm39) start codon destroyed probably null 0.42
R6014:Magi2 UTSW 5 20,816,091 (GRCm39) missense probably damaging 1.00
R6073:Magi2 UTSW 5 20,774,286 (GRCm39) missense probably damaging 1.00
R6500:Magi2 UTSW 5 20,807,345 (GRCm39) missense possibly damaging 0.94
R6664:Magi2 UTSW 5 20,907,395 (GRCm39) missense probably benign 0.00
R7229:Magi2 UTSW 5 20,670,586 (GRCm39) missense probably damaging 1.00
R7344:Magi2 UTSW 5 20,755,238 (GRCm39) missense probably benign 0.19
R7448:Magi2 UTSW 5 20,563,954 (GRCm39) missense probably damaging 1.00
R7605:Magi2 UTSW 5 20,433,383 (GRCm39) missense probably damaging 1.00
R7712:Magi2 UTSW 5 20,755,280 (GRCm39) missense possibly damaging 0.78
R7808:Magi2 UTSW 5 20,670,838 (GRCm39) missense probably benign 0.03
R7955:Magi2 UTSW 5 20,594,070 (GRCm39) missense probably damaging 1.00
R8134:Magi2 UTSW 5 20,596,392 (GRCm39) missense probably benign 0.03
R8134:Magi2 UTSW 5 20,596,365 (GRCm39) missense probably damaging 1.00
R8253:Magi2 UTSW 5 20,814,305 (GRCm39) missense probably benign 0.44
R8481:Magi2 UTSW 5 20,594,152 (GRCm39) missense possibly damaging 0.91
R8553:Magi2 UTSW 5 20,856,198 (GRCm39) missense probably benign 0.00
R8751:Magi2 UTSW 5 20,739,462 (GRCm39) missense probably benign
R8766:Magi2 UTSW 5 20,400,123 (GRCm39) missense probably benign 0.33
R8851:Magi2 UTSW 5 20,270,618 (GRCm39) missense probably damaging 1.00
R8876:Magi2 UTSW 5 20,856,190 (GRCm39) nonsense probably null
R9120:Magi2 UTSW 5 20,733,305 (GRCm39) missense possibly damaging 0.81
R9335:Magi2 UTSW 5 20,866,263 (GRCm39) missense
R9367:Magi2 UTSW 5 20,766,308 (GRCm39) missense probably damaging 0.97
R9454:Magi2 UTSW 5 20,671,176 (GRCm39) missense probably damaging 0.97
R9577:Magi2 UTSW 5 20,814,282 (GRCm39) missense probably damaging 1.00
R9673:Magi2 UTSW 5 20,670,582 (GRCm39) missense possibly damaging 0.86
R9696:Magi2 UTSW 5 20,670,864 (GRCm39) missense probably benign 0.35
X0065:Magi2 UTSW 5 20,774,176 (GRCm39) missense possibly damaging 0.94
Z1176:Magi2 UTSW 5 20,907,107 (GRCm39) missense probably benign 0.32
Z1177:Magi2 UTSW 5 20,907,410 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCAACATGGGCCATTATCTTATGC -3'
(R):5'- ACGCCGTTTCCATTGACTAC -3'

Sequencing Primer
(F):5'- GGGCCATTATCTTATGCATTAAAAC -3'
(R):5'- CGTTTCCATTGACTACAGGCC -3'
Posted On 2022-06-15