Incidental Mutation 'R9474:Shank1'
ID 715639
Institutional Source Beutler Lab
Gene Symbol Shank1
Ensembl Gene ENSMUSG00000038738
Gene Name SH3 and multiple ankyrin repeat domains 1
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.356) question?
Stock # R9474 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 43959677-44009996 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 43962342 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 71 (S71N)
Ref Sequence ENSEMBL: ENSMUSP00000103571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107934] [ENSMUST00000107935] [ENSMUST00000107938]
AlphaFold D3YZU1
Predicted Effect unknown
Transcript: ENSMUST00000107934
AA Change: S71N
SMART Domains Protein: ENSMUSP00000103567
Gene: ENSMUSG00000038738
AA Change: S71N

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
ANK 212 242 5.75e-1 SMART
ANK 246 275 3.6e-2 SMART
ANK 279 309 3.44e1 SMART
ANK 313 342 1.97e1 SMART
ANK 346 375 3.97e-4 SMART
ANK 379 407 5.69e2 SMART
low complexity region 452 479 N/A INTRINSIC
low complexity region 487 504 N/A INTRINSIC
low complexity region 521 548 N/A INTRINSIC
SH3 557 612 3.73e-16 SMART
PDZ 663 752 2.12e-13 SMART
Blast:PDZ 795 830 5e-11 BLAST
low complexity region 920 941 N/A INTRINSIC
low complexity region 955 982 N/A INTRINSIC
low complexity region 993 1023 N/A INTRINSIC
low complexity region 1051 1080 N/A INTRINSIC
low complexity region 1123 1138 N/A INTRINSIC
low complexity region 1162 1175 N/A INTRINSIC
low complexity region 1179 1220 N/A INTRINSIC
low complexity region 1256 1275 N/A INTRINSIC
low complexity region 1298 1323 N/A INTRINSIC
low complexity region 1348 1359 N/A INTRINSIC
low complexity region 1369 1404 N/A INTRINSIC
low complexity region 1450 1466 N/A INTRINSIC
low complexity region 1512 1532 N/A INTRINSIC
low complexity region 1539 1555 N/A INTRINSIC
low complexity region 1557 1570 N/A INTRINSIC
low complexity region 1580 1614 N/A INTRINSIC
low complexity region 1633 1667 N/A INTRINSIC
low complexity region 1685 1720 N/A INTRINSIC
low complexity region 1735 1746 N/A INTRINSIC
low complexity region 1776 1787 N/A INTRINSIC
low complexity region 1806 1823 N/A INTRINSIC
low complexity region 1834 1852 N/A INTRINSIC
low complexity region 1893 1907 N/A INTRINSIC
low complexity region 1925 1936 N/A INTRINSIC
low complexity region 1942 1976 N/A INTRINSIC
low complexity region 1988 2004 N/A INTRINSIC
low complexity region 2009 2029 N/A INTRINSIC
low complexity region 2059 2083 N/A INTRINSIC
SAM 2092 2158 1.35e-14 SMART
Predicted Effect unknown
Transcript: ENSMUST00000107935
AA Change: S71N
SMART Domains Protein: ENSMUSP00000103568
Gene: ENSMUSG00000038738
AA Change: S71N

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
ANK 212 242 5.75e-1 SMART
ANK 246 275 3.6e-2 SMART
ANK 279 309 3.44e1 SMART
ANK 313 342 1.97e1 SMART
ANK 346 375 3.97e-4 SMART
ANK 379 407 5.69e2 SMART
low complexity region 452 479 N/A INTRINSIC
low complexity region 487 504 N/A INTRINSIC
low complexity region 521 548 N/A INTRINSIC
SH3 557 612 3.73e-16 SMART
low complexity region 648 659 N/A INTRINSIC
PDZ 672 761 2.12e-13 SMART
Blast:PDZ 796 831 1e-10 BLAST
low complexity region 921 942 N/A INTRINSIC
low complexity region 956 983 N/A INTRINSIC
low complexity region 994 1024 N/A INTRINSIC
low complexity region 1052 1081 N/A INTRINSIC
low complexity region 1124 1139 N/A INTRINSIC
low complexity region 1163 1176 N/A INTRINSIC
low complexity region 1180 1221 N/A INTRINSIC
low complexity region 1257 1276 N/A INTRINSIC
low complexity region 1299 1324 N/A INTRINSIC
low complexity region 1349 1360 N/A INTRINSIC
low complexity region 1370 1405 N/A INTRINSIC
low complexity region 1451 1467 N/A INTRINSIC
low complexity region 1513 1533 N/A INTRINSIC
low complexity region 1540 1556 N/A INTRINSIC
low complexity region 1558 1571 N/A INTRINSIC
low complexity region 1581 1615 N/A INTRINSIC
low complexity region 1634 1668 N/A INTRINSIC
low complexity region 1686 1721 N/A INTRINSIC
low complexity region 1736 1747 N/A INTRINSIC
low complexity region 1777 1788 N/A INTRINSIC
low complexity region 1807 1824 N/A INTRINSIC
low complexity region 1835 1853 N/A INTRINSIC
low complexity region 1894 1908 N/A INTRINSIC
low complexity region 1926 1937 N/A INTRINSIC
low complexity region 1943 1977 N/A INTRINSIC
low complexity region 1989 2005 N/A INTRINSIC
low complexity region 2010 2030 N/A INTRINSIC
low complexity region 2060 2084 N/A INTRINSIC
SAM 2093 2159 1.35e-14 SMART
Predicted Effect unknown
Transcript: ENSMUST00000107938
AA Change: S71N
SMART Domains Protein: ENSMUSP00000103571
Gene: ENSMUSG00000038738
AA Change: S71N

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
Pfam:FERM_f0 73 156 6.6e-17 PFAM
ANK 212 242 5.75e-1 SMART
ANK 246 275 3.6e-2 SMART
ANK 279 309 3.44e1 SMART
ANK 313 342 1.97e1 SMART
ANK 346 375 3.97e-4 SMART
ANK 379 407 5.69e2 SMART
low complexity region 452 479 N/A INTRINSIC
low complexity region 487 504 N/A INTRINSIC
low complexity region 521 548 N/A INTRINSIC
SH3 557 612 3.73e-16 SMART
low complexity region 648 659 N/A INTRINSIC
PDZ 672 761 2.12e-13 SMART
Blast:PDZ 804 839 5e-11 BLAST
low complexity region 929 950 N/A INTRINSIC
low complexity region 964 991 N/A INTRINSIC
low complexity region 1002 1032 N/A INTRINSIC
low complexity region 1060 1089 N/A INTRINSIC
low complexity region 1132 1147 N/A INTRINSIC
low complexity region 1171 1184 N/A INTRINSIC
low complexity region 1188 1229 N/A INTRINSIC
low complexity region 1265 1284 N/A INTRINSIC
low complexity region 1307 1332 N/A INTRINSIC
low complexity region 1357 1368 N/A INTRINSIC
low complexity region 1378 1413 N/A INTRINSIC
low complexity region 1459 1475 N/A INTRINSIC
low complexity region 1521 1541 N/A INTRINSIC
low complexity region 1548 1564 N/A INTRINSIC
low complexity region 1566 1579 N/A INTRINSIC
low complexity region 1589 1623 N/A INTRINSIC
low complexity region 1642 1676 N/A INTRINSIC
low complexity region 1694 1729 N/A INTRINSIC
low complexity region 1744 1755 N/A INTRINSIC
low complexity region 1785 1796 N/A INTRINSIC
low complexity region 1815 1832 N/A INTRINSIC
low complexity region 1843 1861 N/A INTRINSIC
low complexity region 1902 1916 N/A INTRINSIC
low complexity region 1934 1945 N/A INTRINSIC
low complexity region 1951 1985 N/A INTRINSIC
low complexity region 1997 2013 N/A INTRINSIC
low complexity region 2018 2038 N/A INTRINSIC
low complexity region 2068 2092 N/A INTRINSIC
SAM 2101 2167 1.35e-14 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SHANK (SH3 domain and ankyrin repeat containing) family of proteins. Members of this family act as scaffold proteins that are required for the development and function of neuronal synapses. Deletions in this gene may be associated with autism spectrum disorder in males. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous mutation of this gene results in smaller pyramidal neuron dendritic spines, smaller and thinner postsynaptic density of central excitatory synapses, weaker synaptic transmission, increased anxiety-related behavior, and impaired contextual fearmemory, but enhanced spatial learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik C A 10: 78,903,565 (GRCm39) K250N probably damaging Het
Adam5 A T 8: 25,237,540 (GRCm39) D623E possibly damaging Het
Akt3 T C 1: 176,852,952 (GRCm39) Y473C probably damaging Het
Ankib1 A G 5: 3,805,617 (GRCm39) Y217H probably damaging Het
Clca4b T A 3: 144,616,927 (GRCm39) T908S probably benign Het
Clec7a G A 6: 129,440,126 (GRCm39) Q160* probably null Het
Cntnap4 T A 8: 113,460,103 (GRCm39) I152N probably damaging Het
Ctdspl C T 9: 118,866,445 (GRCm39) A179V probably damaging Het
Ddx43 T C 9: 78,313,668 (GRCm39) S200P probably damaging Het
Dip2c A G 13: 9,544,963 (GRCm39) D84G unknown Het
Dmbt1 G A 7: 130,675,987 (GRCm39) R625H unknown Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 72,684,217 (GRCm39) probably benign Het
E2f7 C T 10: 110,603,050 (GRCm39) T355I probably damaging Het
E2f7 C A 10: 110,614,918 (GRCm39) L541M probably damaging Het
Elovl5 T A 9: 77,890,007 (GRCm39) S273T possibly damaging Het
Emc1 T A 4: 139,093,705 (GRCm39) L605Q probably damaging Het
Fras1 T A 5: 96,887,124 (GRCm39) D2635E probably benign Het
Gabrb1 G A 5: 72,265,690 (GRCm39) G195E probably damaging Het
Galm A G 17: 80,457,561 (GRCm39) D199G possibly damaging Het
Galntl6 T G 8: 58,230,359 (GRCm39) S20R probably damaging Het
Grb14 T G 2: 64,768,744 (GRCm39) Y189S probably damaging Het
Hk2 T A 6: 82,705,895 (GRCm39) I803F probably damaging Het
Hmcn1 G A 1: 150,506,471 (GRCm39) R3779W probably damaging Het
Hmgcr A C 13: 96,796,403 (GRCm39) M260R probably damaging Het
Hsbp1l1 T A 18: 80,276,639 (GRCm39) K68N possibly damaging Het
Inhba A C 13: 16,192,263 (GRCm39) E128A probably benign Het
Itpr3 G A 17: 27,337,651 (GRCm39) probably benign Het
Klhl3 G A 13: 58,167,273 (GRCm39) P364S probably damaging Het
Lhpp T C 7: 132,243,312 (GRCm39) L176P probably damaging Het
Lrp1b C A 2: 40,491,599 (GRCm39) A223S probably damaging Het
Lrp3 A G 7: 34,903,489 (GRCm39) F286L probably damaging Het
Lrrc7 T C 3: 157,841,028 (GRCm39) T1337A probably benign Het
Magi2 A G 5: 20,400,019 (GRCm39) D17G probably benign Het
Map3k21 T C 8: 126,650,903 (GRCm39) S302P probably damaging Het
Matcap2 T C 9: 22,343,015 (GRCm39) M303T probably damaging Het
Mbtd1 A G 11: 93,816,511 (GRCm39) D386G probably benign Het
Mfsd2b A T 12: 4,916,820 (GRCm39) D306E possibly damaging Het
Muc20 T C 16: 32,614,453 (GRCm39) E308G probably damaging Het
Myh13 G A 11: 67,255,712 (GRCm39) S34N Het
Nebl C A 2: 17,374,421 (GRCm39) G894* probably null Het
Nelfa A G 5: 34,056,095 (GRCm39) Y523H probably damaging Het
Ninj1 A G 13: 49,341,076 (GRCm39) D13G probably benign Het
Ninl A T 2: 150,782,726 (GRCm39) S170T probably benign Het
Nlrp4c G A 7: 6,068,626 (GRCm39) V176M possibly damaging Het
Nobox G A 6: 43,284,115 (GRCm39) R144C probably damaging Het
Oas1a G A 5: 121,037,317 (GRCm39) L237F probably damaging Het
Or4a81 A C 2: 89,619,506 (GRCm39) Y63* probably null Het
Or52z15 A T 7: 103,332,477 (GRCm39) Y184F probably damaging Het
Or5w20 T C 2: 87,726,693 (GRCm39) M50T probably benign Het
Or6z1 A G 7: 6,505,150 (GRCm39) L25P probably benign Het
Or7c70 T C 10: 78,682,891 (GRCm39) N286S probably damaging Het
Or8h9 A G 2: 86,789,757 (GRCm39) M15T probably benign Het
Orai1 A G 5: 123,167,301 (GRCm39) N158S probably damaging Het
Pa2g4 C A 10: 128,398,967 (GRCm39) V121L probably benign Het
Pclo T C 5: 14,571,250 (GRCm39) S212P possibly damaging Het
Plce1 G A 19: 38,766,337 (GRCm39) E2121K possibly damaging Het
Plg A G 17: 12,622,024 (GRCm39) Y448C probably damaging Het
Plppr4 A T 3: 117,116,866 (GRCm39) N330K probably damaging Het
Pou2f2 A G 7: 24,794,247 (GRCm39) L373S probably benign Het
Rnpep A G 1: 135,211,341 (GRCm39) F136L probably benign Het
Rp1 A G 1: 4,162,838 (GRCm39) probably null Het
Slc5a4a GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC 10: 75,986,238 (GRCm39) probably benign Het
Slc5a5 T C 8: 71,337,596 (GRCm39) D574G probably benign Het
Slc7a15 T A 12: 8,588,794 (GRCm39) N251I probably damaging Het
Speer4a3 A T 5: 26,158,136 (GRCm39) I72N probably damaging Het
Susd4 T C 1: 182,719,665 (GRCm39) S427P probably benign Het
Tarbp1 T A 8: 127,155,779 (GRCm39) T1320S probably benign Het
Tbpl2 C T 2: 23,984,650 (GRCm39) V166I probably benign Het
Thbs1 T C 2: 117,950,518 (GRCm39) probably null Het
Tnfsf13b A G 8: 10,081,648 (GRCm39) Y270C probably damaging Het
Vps11 G T 9: 44,260,290 (GRCm39) C857* probably null Het
Vsig10 G A 5: 117,463,104 (GRCm39) R110H probably benign Het
Wee2 T A 6: 40,432,044 (GRCm39) Y204* probably null Het
Zfpm2 T A 15: 40,966,867 (GRCm39) S1117R probably damaging Het
Zscan5b A G 7: 6,234,472 (GRCm39) N166S probably benign Het
Other mutations in Shank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Shank1 APN 7 44,003,662 (GRCm39) missense possibly damaging 0.89
IGL01293:Shank1 APN 7 44,003,660 (GRCm39) missense possibly damaging 0.59
IGL01319:Shank1 APN 7 44,002,547 (GRCm39) missense possibly damaging 0.93
IGL01347:Shank1 APN 7 43,991,544 (GRCm39) missense unknown
IGL01621:Shank1 APN 7 44,001,023 (GRCm39) missense unknown
IGL01621:Shank1 APN 7 43,991,889 (GRCm39) missense unknown
IGL01964:Shank1 APN 7 43,975,102 (GRCm39) missense unknown
IGL02309:Shank1 APN 7 43,962,266 (GRCm39) missense unknown
IGL02325:Shank1 APN 7 43,976,504 (GRCm39) nonsense probably null
IGL02387:Shank1 APN 7 44,006,361 (GRCm39) missense possibly damaging 0.77
IGL02958:Shank1 APN 7 44,003,897 (GRCm39) missense possibly damaging 0.59
R0098:Shank1 UTSW 7 43,962,709 (GRCm39) missense unknown
R0098:Shank1 UTSW 7 43,962,709 (GRCm39) missense unknown
R0197:Shank1 UTSW 7 44,001,718 (GRCm39) missense unknown
R0326:Shank1 UTSW 7 43,968,594 (GRCm39) missense unknown
R0365:Shank1 UTSW 7 44,003,401 (GRCm39) missense possibly damaging 0.89
R0883:Shank1 UTSW 7 44,001,718 (GRCm39) missense unknown
R1033:Shank1 UTSW 7 44,006,220 (GRCm39) missense possibly damaging 0.77
R1390:Shank1 UTSW 7 44,006,462 (GRCm39) missense probably damaging 1.00
R1453:Shank1 UTSW 7 43,965,499 (GRCm39) missense unknown
R1594:Shank1 UTSW 7 43,976,647 (GRCm39) nonsense probably null
R1713:Shank1 UTSW 7 43,969,161 (GRCm39) missense unknown
R1783:Shank1 UTSW 7 44,002,161 (GRCm39) missense possibly damaging 0.70
R1869:Shank1 UTSW 7 43,991,539 (GRCm39) nonsense probably null
R1870:Shank1 UTSW 7 43,991,539 (GRCm39) nonsense probably null
R1959:Shank1 UTSW 7 43,974,801 (GRCm39) missense unknown
R1962:Shank1 UTSW 7 43,993,747 (GRCm39) critical splice donor site probably null
R2406:Shank1 UTSW 7 44,006,376 (GRCm39) missense possibly damaging 0.94
R2509:Shank1 UTSW 7 44,001,547 (GRCm39) missense unknown
R2509:Shank1 UTSW 7 44,001,148 (GRCm39) missense unknown
R3877:Shank1 UTSW 7 43,994,416 (GRCm39) missense unknown
R4041:Shank1 UTSW 7 43,991,586 (GRCm39) missense unknown
R4249:Shank1 UTSW 7 43,969,160 (GRCm39) missense unknown
R4303:Shank1 UTSW 7 43,991,898 (GRCm39) missense unknown
R4431:Shank1 UTSW 7 43,969,076 (GRCm39) nonsense probably null
R4525:Shank1 UTSW 7 44,004,014 (GRCm39) missense possibly damaging 0.77
R4527:Shank1 UTSW 7 44,004,014 (GRCm39) missense possibly damaging 0.77
R4642:Shank1 UTSW 7 43,962,565 (GRCm39) missense unknown
R4722:Shank1 UTSW 7 43,962,638 (GRCm39) nonsense probably null
R4805:Shank1 UTSW 7 43,993,135 (GRCm39) missense unknown
R4874:Shank1 UTSW 7 43,965,497 (GRCm39) missense unknown
R4904:Shank1 UTSW 7 43,983,464 (GRCm39) intron probably benign
R4939:Shank1 UTSW 7 43,975,586 (GRCm39) missense unknown
R5394:Shank1 UTSW 7 44,002,075 (GRCm39) missense possibly damaging 0.85
R5410:Shank1 UTSW 7 44,001,246 (GRCm39) missense unknown
R5556:Shank1 UTSW 7 43,993,739 (GRCm39) intron probably benign
R5620:Shank1 UTSW 7 43,962,160 (GRCm39) missense unknown
R5656:Shank1 UTSW 7 44,002,310 (GRCm39) missense probably benign 0.33
R5688:Shank1 UTSW 7 44,003,911 (GRCm39) missense possibly damaging 0.77
R5740:Shank1 UTSW 7 44,003,164 (GRCm39) missense possibly damaging 0.89
R5801:Shank1 UTSW 7 44,006,240 (GRCm39) missense possibly damaging 0.77
R6179:Shank1 UTSW 7 44,006,630 (GRCm39) missense possibly damaging 0.58
R6186:Shank1 UTSW 7 44,001,990 (GRCm39) missense probably benign 0.18
R6245:Shank1 UTSW 7 44,001,677 (GRCm39) missense unknown
R6500:Shank1 UTSW 7 43,976,645 (GRCm39) missense unknown
R6602:Shank1 UTSW 7 44,001,760 (GRCm39) missense probably benign 0.03
R6655:Shank1 UTSW 7 43,976,644 (GRCm39) missense unknown
R6709:Shank1 UTSW 7 44,003,600 (GRCm39) missense probably benign 0.43
R6734:Shank1 UTSW 7 44,003,110 (GRCm39) missense probably benign 0.01
R6881:Shank1 UTSW 7 44,001,217 (GRCm39) missense unknown
R6902:Shank1 UTSW 7 44,006,239 (GRCm39) missense probably benign 0.39
R6975:Shank1 UTSW 7 43,962,530 (GRCm39) splice site probably null
R6985:Shank1 UTSW 7 43,994,337 (GRCm39) missense unknown
R7072:Shank1 UTSW 7 43,994,370 (GRCm39) missense unknown
R7116:Shank1 UTSW 7 43,976,585 (GRCm39) missense unknown
R7117:Shank1 UTSW 7 43,976,585 (GRCm39) missense unknown
R7199:Shank1 UTSW 7 44,002,564 (GRCm39) missense possibly damaging 0.86
R7249:Shank1 UTSW 7 43,976,585 (GRCm39) missense unknown
R7252:Shank1 UTSW 7 43,976,585 (GRCm39) missense unknown
R7552:Shank1 UTSW 7 44,002,452 (GRCm39) missense probably benign 0.00
R7653:Shank1 UTSW 7 43,969,093 (GRCm39) missense unknown
R7707:Shank1 UTSW 7 43,993,725 (GRCm39) missense unknown
R7801:Shank1 UTSW 7 44,001,022 (GRCm39) missense unknown
R7804:Shank1 UTSW 7 43,962,308 (GRCm39) missense unknown
R8122:Shank1 UTSW 7 43,983,015 (GRCm39) missense unknown
R8178:Shank1 UTSW 7 43,962,748 (GRCm39) critical splice donor site probably null
R8339:Shank1 UTSW 7 43,975,589 (GRCm39) missense unknown
R8463:Shank1 UTSW 7 44,003,605 (GRCm39) missense possibly damaging 0.77
R9005:Shank1 UTSW 7 44,002,409 (GRCm39) missense probably benign 0.00
R9023:Shank1 UTSW 7 43,968,531 (GRCm39) missense unknown
R9225:Shank1 UTSW 7 43,983,470 (GRCm39) missense unknown
R9234:Shank1 UTSW 7 43,962,579 (GRCm39) missense unknown
R9369:Shank1 UTSW 7 44,001,478 (GRCm39) missense unknown
R9432:Shank1 UTSW 7 43,962,342 (GRCm39) missense unknown
R9433:Shank1 UTSW 7 43,962,342 (GRCm39) missense unknown
R9434:Shank1 UTSW 7 43,962,342 (GRCm39) missense unknown
R9467:Shank1 UTSW 7 43,962,342 (GRCm39) missense unknown
R9475:Shank1 UTSW 7 43,962,342 (GRCm39) missense unknown
R9476:Shank1 UTSW 7 43,962,342 (GRCm39) missense unknown
R9477:Shank1 UTSW 7 43,962,342 (GRCm39) missense unknown
R9519:Shank1 UTSW 7 43,962,342 (GRCm39) missense unknown
R9544:Shank1 UTSW 7 43,962,342 (GRCm39) missense unknown
R9545:Shank1 UTSW 7 43,962,342 (GRCm39) missense unknown
R9598:Shank1 UTSW 7 43,962,342 (GRCm39) missense unknown
R9633:Shank1 UTSW 7 43,962,342 (GRCm39) missense unknown
R9698:Shank1 UTSW 7 43,962,342 (GRCm39) missense unknown
R9699:Shank1 UTSW 7 43,962,342 (GRCm39) missense unknown
R9701:Shank1 UTSW 7 43,962,342 (GRCm39) missense unknown
R9755:Shank1 UTSW 7 43,962,342 (GRCm39) missense unknown
R9783:Shank1 UTSW 7 43,962,342 (GRCm39) missense unknown
R9784:Shank1 UTSW 7 43,962,342 (GRCm39) missense unknown
R9800:Shank1 UTSW 7 43,962,342 (GRCm39) missense unknown
R9802:Shank1 UTSW 7 43,962,342 (GRCm39) missense unknown
R9803:Shank1 UTSW 7 43,962,342 (GRCm39) missense unknown
X0019:Shank1 UTSW 7 44,006,352 (GRCm39) missense probably damaging 1.00
X0065:Shank1 UTSW 7 44,001,353 (GRCm39) missense unknown
Z1088:Shank1 UTSW 7 44,001,590 (GRCm39) missense unknown
Z1177:Shank1 UTSW 7 43,975,068 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TTCTCAGCTGCCTGTGATGC -3'
(R):5'- AGGCATTTCTGGTGGGAGAC -3'

Sequencing Primer
(F):5'- GCCTGTGATGCTGCTGTCC -3'
(R):5'- CATTTCTGGTGGGAGACAGGATG -3'
Posted On 2022-06-15