Incidental Mutation 'R9474:Dmbt1'
ID 715641
Institutional Source Beutler Lab
Gene Symbol Dmbt1
Ensembl Gene ENSMUSG00000047517
Gene Name deleted in malignant brain tumors 1
Synonyms Crpd, gp300, hensin, CRP-[b], MUCLIN, ebnerin, CRP-[a], vomeroglandin
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.239) question?
Stock # R9474 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 130633787-130723357 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 130675987 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 625 (R625H)
Ref Sequence ENSEMBL: ENSMUSP00000146685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084509] [ENSMUST00000124096] [ENSMUST00000208311] [ENSMUST00000213064]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000084509
AA Change: R614H
SMART Domains Protein: ENSMUSP00000081556
Gene: ENSMUSG00000047517
AA Change: R614H

DomainStartEndE-ValueType
SR 37 137 5.54e-59 SMART
SR 186 286 3.6e-58 SMART
SR 324 424 1.21e-59 SMART
SR 463 563 2.97e-59 SMART
SR 602 702 3.36e-58 SMART
SR 741 841 5.17e-59 SMART
low complexity region 848 879 N/A INTRINSIC
CUB 884 993 4.22e-41 SMART
CUB 1000 1109 7.35e-41 SMART
CUB 1126 1235 3.73e-42 SMART
CUB 1242 1351 2.02e-38 SMART
SR 1371 1471 3.92e-59 SMART
low complexity region 1476 1488 N/A INTRINSIC
CUB 1494 1603 6.7e-44 SMART
ZP 1612 1860 8.11e-74 SMART
transmembrane domain 1906 1928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000208311
AA Change: R625H
Predicted Effect probably benign
Transcript: ENSMUST00000213064
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Loss of sequences from human chromosome 10q has been associated with the progression of human cancers. This gene was originally isolated based on its deletion in a medulloblastoma cell line. This gene is expressed with transcripts of 6.0, 7.5, and 8.0 kb in fetal lung and with one transcript of 8.0 kb in adult lung, although the 7.5 kb transcript has not been characterized. The encoded protein precursor is a glycoprotein containing multiple scavenger receptor cysteine-rich (SRCR) domains separated by SRCR-interspersed domains (SID). Transcript variant 2 (8.0 kb) has been shown to bind surfactant protein D independently of carbohydrate recognition. This indicates that DMBT1 may not be a classical tumor suppressor gene, but rather play a role in the interaction of tumor cells and the immune system. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for one null allele display embryonic lethality and an abnormal inner cell mass. Mice homozygous for a different null allele are viable and fertile with an increased susceptibility to induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik C A 10: 78,903,565 (GRCm39) K250N probably damaging Het
Adam5 A T 8: 25,237,540 (GRCm39) D623E possibly damaging Het
Akt3 T C 1: 176,852,952 (GRCm39) Y473C probably damaging Het
Ankib1 A G 5: 3,805,617 (GRCm39) Y217H probably damaging Het
Clca4b T A 3: 144,616,927 (GRCm39) T908S probably benign Het
Clec7a G A 6: 129,440,126 (GRCm39) Q160* probably null Het
Cntnap4 T A 8: 113,460,103 (GRCm39) I152N probably damaging Het
Ctdspl C T 9: 118,866,445 (GRCm39) A179V probably damaging Het
Ddx43 T C 9: 78,313,668 (GRCm39) S200P probably damaging Het
Dip2c A G 13: 9,544,963 (GRCm39) D84G unknown Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 72,684,217 (GRCm39) probably benign Het
E2f7 C T 10: 110,603,050 (GRCm39) T355I probably damaging Het
E2f7 C A 10: 110,614,918 (GRCm39) L541M probably damaging Het
Elovl5 T A 9: 77,890,007 (GRCm39) S273T possibly damaging Het
Emc1 T A 4: 139,093,705 (GRCm39) L605Q probably damaging Het
Fras1 T A 5: 96,887,124 (GRCm39) D2635E probably benign Het
Gabrb1 G A 5: 72,265,690 (GRCm39) G195E probably damaging Het
Galm A G 17: 80,457,561 (GRCm39) D199G possibly damaging Het
Galntl6 T G 8: 58,230,359 (GRCm39) S20R probably damaging Het
Grb14 T G 2: 64,768,744 (GRCm39) Y189S probably damaging Het
Hk2 T A 6: 82,705,895 (GRCm39) I803F probably damaging Het
Hmcn1 G A 1: 150,506,471 (GRCm39) R3779W probably damaging Het
Hmgcr A C 13: 96,796,403 (GRCm39) M260R probably damaging Het
Hsbp1l1 T A 18: 80,276,639 (GRCm39) K68N possibly damaging Het
Inhba A C 13: 16,192,263 (GRCm39) E128A probably benign Het
Itpr3 G A 17: 27,337,651 (GRCm39) probably benign Het
Klhl3 G A 13: 58,167,273 (GRCm39) P364S probably damaging Het
Lhpp T C 7: 132,243,312 (GRCm39) L176P probably damaging Het
Lrp1b C A 2: 40,491,599 (GRCm39) A223S probably damaging Het
Lrp3 A G 7: 34,903,489 (GRCm39) F286L probably damaging Het
Lrrc7 T C 3: 157,841,028 (GRCm39) T1337A probably benign Het
Magi2 A G 5: 20,400,019 (GRCm39) D17G probably benign Het
Map3k21 T C 8: 126,650,903 (GRCm39) S302P probably damaging Het
Matcap2 T C 9: 22,343,015 (GRCm39) M303T probably damaging Het
Mbtd1 A G 11: 93,816,511 (GRCm39) D386G probably benign Het
Mfsd2b A T 12: 4,916,820 (GRCm39) D306E possibly damaging Het
Muc20 T C 16: 32,614,453 (GRCm39) E308G probably damaging Het
Myh13 G A 11: 67,255,712 (GRCm39) S34N Het
Nebl C A 2: 17,374,421 (GRCm39) G894* probably null Het
Nelfa A G 5: 34,056,095 (GRCm39) Y523H probably damaging Het
Ninj1 A G 13: 49,341,076 (GRCm39) D13G probably benign Het
Ninl A T 2: 150,782,726 (GRCm39) S170T probably benign Het
Nlrp4c G A 7: 6,068,626 (GRCm39) V176M possibly damaging Het
Nobox G A 6: 43,284,115 (GRCm39) R144C probably damaging Het
Oas1a G A 5: 121,037,317 (GRCm39) L237F probably damaging Het
Or4a81 A C 2: 89,619,506 (GRCm39) Y63* probably null Het
Or52z15 A T 7: 103,332,477 (GRCm39) Y184F probably damaging Het
Or5w20 T C 2: 87,726,693 (GRCm39) M50T probably benign Het
Or6z1 A G 7: 6,505,150 (GRCm39) L25P probably benign Het
Or7c70 T C 10: 78,682,891 (GRCm39) N286S probably damaging Het
Or8h9 A G 2: 86,789,757 (GRCm39) M15T probably benign Het
Orai1 A G 5: 123,167,301 (GRCm39) N158S probably damaging Het
Pa2g4 C A 10: 128,398,967 (GRCm39) V121L probably benign Het
Pclo T C 5: 14,571,250 (GRCm39) S212P possibly damaging Het
Plce1 G A 19: 38,766,337 (GRCm39) E2121K possibly damaging Het
Plg A G 17: 12,622,024 (GRCm39) Y448C probably damaging Het
Plppr4 A T 3: 117,116,866 (GRCm39) N330K probably damaging Het
Pou2f2 A G 7: 24,794,247 (GRCm39) L373S probably benign Het
Rnpep A G 1: 135,211,341 (GRCm39) F136L probably benign Het
Rp1 A G 1: 4,162,838 (GRCm39) probably null Het
Shank1 G A 7: 43,962,342 (GRCm39) S71N unknown Het
Slc5a4a GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC 10: 75,986,238 (GRCm39) probably benign Het
Slc5a5 T C 8: 71,337,596 (GRCm39) D574G probably benign Het
Slc7a15 T A 12: 8,588,794 (GRCm39) N251I probably damaging Het
Speer4a3 A T 5: 26,158,136 (GRCm39) I72N probably damaging Het
Susd4 T C 1: 182,719,665 (GRCm39) S427P probably benign Het
Tarbp1 T A 8: 127,155,779 (GRCm39) T1320S probably benign Het
Tbpl2 C T 2: 23,984,650 (GRCm39) V166I probably benign Het
Thbs1 T C 2: 117,950,518 (GRCm39) probably null Het
Tnfsf13b A G 8: 10,081,648 (GRCm39) Y270C probably damaging Het
Vps11 G T 9: 44,260,290 (GRCm39) C857* probably null Het
Vsig10 G A 5: 117,463,104 (GRCm39) R110H probably benign Het
Wee2 T A 6: 40,432,044 (GRCm39) Y204* probably null Het
Zfpm2 T A 15: 40,966,867 (GRCm39) S1117R probably damaging Het
Zscan5b A G 7: 6,234,472 (GRCm39) N166S probably benign Het
Other mutations in Dmbt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Dmbt1 APN 7 130,681,270 (GRCm39) intron probably benign
IGL00161:Dmbt1 APN 7 130,711,357 (GRCm39) missense probably damaging 1.00
IGL00331:Dmbt1 APN 7 130,701,020 (GRCm39) missense possibly damaging 0.46
IGL00769:Dmbt1 APN 7 130,684,230 (GRCm39) missense probably damaging 0.99
IGL00792:Dmbt1 APN 7 130,699,337 (GRCm39) missense possibly damaging 0.66
IGL00823:Dmbt1 APN 7 130,659,888 (GRCm39) missense probably benign 0.26
IGL01072:Dmbt1 APN 7 130,687,098 (GRCm39) splice site probably benign
IGL01317:Dmbt1 APN 7 130,642,921 (GRCm39) missense probably damaging 1.00
IGL01335:Dmbt1 APN 7 130,690,497 (GRCm39) missense possibly damaging 0.95
IGL01372:Dmbt1 APN 7 130,705,409 (GRCm39) missense possibly damaging 0.90
IGL01511:Dmbt1 APN 7 130,718,457 (GRCm39) missense possibly damaging 0.49
IGL01627:Dmbt1 APN 7 130,682,915 (GRCm39) missense probably benign 0.14
IGL01890:Dmbt1 APN 7 130,676,149 (GRCm39) intron probably benign
IGL02160:Dmbt1 APN 7 130,684,418 (GRCm39) missense probably damaging 1.00
IGL02186:Dmbt1 APN 7 130,694,986 (GRCm39) splice site probably benign
IGL02197:Dmbt1 APN 7 130,687,152 (GRCm39) splice site probably benign
IGL02332:Dmbt1 APN 7 130,668,343 (GRCm39) intron probably benign
IGL02427:Dmbt1 APN 7 130,689,815 (GRCm39) splice site probably null
IGL02726:Dmbt1 APN 7 130,676,140 (GRCm39) intron probably benign
IGL02967:Dmbt1 APN 7 130,672,919 (GRCm39) missense possibly damaging 0.70
IGL03003:Dmbt1 APN 7 130,684,409 (GRCm39) missense probably benign 0.05
IGL03089:Dmbt1 APN 7 130,712,778 (GRCm39) missense probably damaging 0.99
cavity UTSW 7 130,713,965 (GRCm39) missense unknown
lacunar UTSW 7 130,699,361 (GRCm39) missense probably damaging 0.97
BB005:Dmbt1 UTSW 7 130,639,620 (GRCm39) missense probably benign 0.16
BB015:Dmbt1 UTSW 7 130,639,620 (GRCm39) missense probably benign 0.16
H8562:Dmbt1 UTSW 7 130,713,805 (GRCm39) nonsense probably null
K3955:Dmbt1 UTSW 7 130,721,293 (GRCm39) missense probably damaging 0.98
R0051:Dmbt1 UTSW 7 130,721,225 (GRCm39) missense possibly damaging 0.79
R0051:Dmbt1 UTSW 7 130,721,225 (GRCm39) missense possibly damaging 0.79
R0257:Dmbt1 UTSW 7 130,708,123 (GRCm39) missense probably damaging 1.00
R0388:Dmbt1 UTSW 7 130,697,779 (GRCm39) splice site probably benign
R0427:Dmbt1 UTSW 7 130,642,632 (GRCm39) nonsense probably null
R0478:Dmbt1 UTSW 7 130,642,917 (GRCm39) missense possibly damaging 0.93
R0502:Dmbt1 UTSW 7 130,699,403 (GRCm39) splice site probably null
R0538:Dmbt1 UTSW 7 130,651,631 (GRCm39) splice site probably benign
R0626:Dmbt1 UTSW 7 130,703,811 (GRCm39) missense probably damaging 0.97
R0631:Dmbt1 UTSW 7 130,699,383 (GRCm39) missense possibly damaging 0.90
R0948:Dmbt1 UTSW 7 130,694,847 (GRCm39) missense possibly damaging 0.95
R1169:Dmbt1 UTSW 7 130,676,254 (GRCm39) critical splice donor site probably null
R1413:Dmbt1 UTSW 7 130,651,944 (GRCm39) missense probably damaging 1.00
R1458:Dmbt1 UTSW 7 130,646,217 (GRCm39) splice site probably benign
R1463:Dmbt1 UTSW 7 130,711,366 (GRCm39) critical splice donor site probably null
R1509:Dmbt1 UTSW 7 130,676,061 (GRCm39) intron probably benign
R1990:Dmbt1 UTSW 7 130,660,018 (GRCm39) missense probably damaging 0.98
R2018:Dmbt1 UTSW 7 130,712,718 (GRCm39) missense possibly damaging 0.93
R2019:Dmbt1 UTSW 7 130,712,718 (GRCm39) missense possibly damaging 0.93
R2042:Dmbt1 UTSW 7 130,708,089 (GRCm39) missense probably damaging 0.99
R2056:Dmbt1 UTSW 7 130,707,900 (GRCm39) missense possibly damaging 0.80
R2057:Dmbt1 UTSW 7 130,707,900 (GRCm39) missense possibly damaging 0.80
R2058:Dmbt1 UTSW 7 130,707,900 (GRCm39) missense possibly damaging 0.80
R2059:Dmbt1 UTSW 7 130,707,900 (GRCm39) missense possibly damaging 0.80
R2061:Dmbt1 UTSW 7 130,700,863 (GRCm39) missense possibly damaging 0.66
R2092:Dmbt1 UTSW 7 130,651,748 (GRCm39) missense probably damaging 1.00
R2102:Dmbt1 UTSW 7 130,703,762 (GRCm39) missense probably damaging 0.97
R2155:Dmbt1 UTSW 7 130,699,305 (GRCm39) missense possibly damaging 0.66
R2243:Dmbt1 UTSW 7 130,648,292 (GRCm39) missense probably benign 0.03
R2256:Dmbt1 UTSW 7 130,692,224 (GRCm39) missense probably benign 0.01
R2391:Dmbt1 UTSW 7 130,708,198 (GRCm39) missense probably damaging 1.00
R2394:Dmbt1 UTSW 7 130,696,464 (GRCm39) nonsense probably null
R3014:Dmbt1 UTSW 7 130,633,827 (GRCm39) intron probably benign
R3155:Dmbt1 UTSW 7 130,651,887 (GRCm39) nonsense probably null
R3176:Dmbt1 UTSW 7 130,689,801 (GRCm39) missense probably benign 0.19
R3276:Dmbt1 UTSW 7 130,689,801 (GRCm39) missense probably benign 0.19
R3442:Dmbt1 UTSW 7 130,707,979 (GRCm39) missense probably damaging 1.00
R3807:Dmbt1 UTSW 7 130,713,819 (GRCm39) missense possibly damaging 0.77
R4060:Dmbt1 UTSW 7 130,675,932 (GRCm39) intron probably benign
R4396:Dmbt1 UTSW 7 130,718,361 (GRCm39) missense probably damaging 0.98
R4453:Dmbt1 UTSW 7 130,642,664 (GRCm39) missense probably damaging 1.00
R5001:Dmbt1 UTSW 7 130,651,742 (GRCm39) missense probably damaging 1.00
R5051:Dmbt1 UTSW 7 130,696,472 (GRCm39) missense probably benign 0.01
R5156:Dmbt1 UTSW 7 130,699,400 (GRCm39) critical splice donor site probably null
R5225:Dmbt1 UTSW 7 130,696,465 (GRCm39) missense possibly damaging 0.84
R5281:Dmbt1 UTSW 7 130,684,349 (GRCm39) missense probably damaging 1.00
R5308:Dmbt1 UTSW 7 130,642,751 (GRCm39) missense probably damaging 1.00
R5447:Dmbt1 UTSW 7 130,721,240 (GRCm39) missense probably damaging 0.99
R5467:Dmbt1 UTSW 7 130,642,723 (GRCm39) missense probably damaging 1.00
R5497:Dmbt1 UTSW 7 130,665,133 (GRCm39) intron probably benign
R5526:Dmbt1 UTSW 7 130,642,920 (GRCm39) missense probably damaging 1.00
R5554:Dmbt1 UTSW 7 130,701,030 (GRCm39) nonsense probably null
R5566:Dmbt1 UTSW 7 130,708,003 (GRCm39) missense probably damaging 1.00
R5595:Dmbt1 UTSW 7 130,655,797 (GRCm39) missense probably benign 0.17
R6154:Dmbt1 UTSW 7 130,711,370 (GRCm39) splice site probably null
R6188:Dmbt1 UTSW 7 130,699,361 (GRCm39) missense probably damaging 0.97
R6214:Dmbt1 UTSW 7 130,668,463 (GRCm39) missense possibly damaging 0.95
R6215:Dmbt1 UTSW 7 130,668,463 (GRCm39) missense possibly damaging 0.95
R6391:Dmbt1 UTSW 7 130,659,984 (GRCm39) missense probably damaging 1.00
R6397:Dmbt1 UTSW 7 130,705,308 (GRCm39) missense possibly damaging 0.46
R6436:Dmbt1 UTSW 7 130,718,370 (GRCm39) missense probably benign 0.01
R6603:Dmbt1 UTSW 7 130,648,240 (GRCm39) splice site probably null
R6719:Dmbt1 UTSW 7 130,721,332 (GRCm39) missense possibly damaging 0.83
R6781:Dmbt1 UTSW 7 130,648,291 (GRCm39) missense probably benign 0.16
R7148:Dmbt1 UTSW 7 130,668,464 (GRCm39) nonsense probably null
R7191:Dmbt1 UTSW 7 130,646,250 (GRCm39) missense unknown
R7269:Dmbt1 UTSW 7 130,668,351 (GRCm39) missense unknown
R7288:Dmbt1 UTSW 7 130,685,519 (GRCm39) nonsense probably null
R7296:Dmbt1 UTSW 7 130,713,861 (GRCm39) missense unknown
R7349:Dmbt1 UTSW 7 130,642,854 (GRCm39) missense unknown
R7386:Dmbt1 UTSW 7 130,713,965 (GRCm39) missense unknown
R7428:Dmbt1 UTSW 7 130,710,192 (GRCm39) missense possibly damaging 0.53
R7481:Dmbt1 UTSW 7 130,681,241 (GRCm39) critical splice acceptor site probably null
R7486:Dmbt1 UTSW 7 130,668,192 (GRCm39) missense unknown
R7513:Dmbt1 UTSW 7 130,692,242 (GRCm39) missense unknown
R7553:Dmbt1 UTSW 7 130,706,597 (GRCm39) missense unknown
R7567:Dmbt1 UTSW 7 130,663,093 (GRCm39) splice site probably null
R7584:Dmbt1 UTSW 7 130,690,481 (GRCm39) nonsense probably null
R7736:Dmbt1 UTSW 7 130,718,625 (GRCm39) missense unknown
R7758:Dmbt1 UTSW 7 130,722,926 (GRCm39) missense unknown
R7928:Dmbt1 UTSW 7 130,639,620 (GRCm39) missense probably benign 0.16
R8080:Dmbt1 UTSW 7 130,690,500 (GRCm39) missense unknown
R8098:Dmbt1 UTSW 7 130,710,188 (GRCm39) nonsense probably null
R8125:Dmbt1 UTSW 7 130,700,953 (GRCm39) missense unknown
R8177:Dmbt1 UTSW 7 130,708,162 (GRCm39) missense possibly damaging 0.46
R8350:Dmbt1 UTSW 7 130,687,147 (GRCm39) critical splice donor site probably null
R8366:Dmbt1 UTSW 7 130,668,330 (GRCm39) missense unknown
R8378:Dmbt1 UTSW 7 130,708,195 (GRCm39) missense probably damaging 0.96
R8399:Dmbt1 UTSW 7 130,684,317 (GRCm39) missense unknown
R8400:Dmbt1 UTSW 7 130,684,317 (GRCm39) missense unknown
R8445:Dmbt1 UTSW 7 130,692,110 (GRCm39) missense unknown
R8450:Dmbt1 UTSW 7 130,687,147 (GRCm39) critical splice donor site probably null
R8511:Dmbt1 UTSW 7 130,703,742 (GRCm39) missense unknown
R8688:Dmbt1 UTSW 7 130,659,984 (GRCm39) missense unknown
R8850:Dmbt1 UTSW 7 130,692,134 (GRCm39) missense unknown
R8852:Dmbt1 UTSW 7 130,642,853 (GRCm39) missense unknown
R8871:Dmbt1 UTSW 7 130,718,597 (GRCm39) missense unknown
R8943:Dmbt1 UTSW 7 130,721,372 (GRCm39) missense possibly damaging 0.68
R8978:Dmbt1 UTSW 7 130,639,611 (GRCm39) missense possibly damaging 0.53
R9004:Dmbt1 UTSW 7 130,713,798 (GRCm39) missense unknown
R9020:Dmbt1 UTSW 7 130,712,787 (GRCm39) missense possibly damaging 0.86
R9088:Dmbt1 UTSW 7 130,718,418 (GRCm39) missense unknown
R9230:Dmbt1 UTSW 7 130,639,642 (GRCm39) missense probably benign 0.01
R9304:Dmbt1 UTSW 7 130,700,855 (GRCm39) missense unknown
R9377:Dmbt1 UTSW 7 130,694,832 (GRCm39) missense unknown
R9428:Dmbt1 UTSW 7 130,668,208 (GRCm39) missense unknown
R9573:Dmbt1 UTSW 7 130,657,910 (GRCm39) critical splice donor site probably null
R9675:Dmbt1 UTSW 7 130,712,652 (GRCm39) missense probably damaging 0.98
R9689:Dmbt1 UTSW 7 130,660,015 (GRCm39) missense unknown
R9781:Dmbt1 UTSW 7 130,639,599 (GRCm39) missense probably benign 0.00
X0024:Dmbt1 UTSW 7 130,713,977 (GRCm39) nonsense probably null
X0062:Dmbt1 UTSW 7 130,696,581 (GRCm39) missense possibly damaging 0.81
Z1176:Dmbt1 UTSW 7 130,690,542 (GRCm39) missense unknown
Z1177:Dmbt1 UTSW 7 130,684,215 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGCAGCAGGAGTTATTCATATCC -3'
(R):5'- AGTTATGAGAGAGCCAGCCTC -3'

Sequencing Primer
(F):5'- ATCCCATATTGTTCATGAGTGAGTG -3'
(R):5'- GATAGTCCTCATAGCCTCCACAGG -3'
Posted On 2022-06-15