Mutagenetix > Incidental Mutation

Incidental Mutation 'R9474:Dmbt1'

715641

Institutional Source

Beutler Lab

Gene Symbol

Dmbt1

Ensembl Gene

ENSMUSG00000047517

Gene Name

deleted in malignant brain tumors 1

Synonyms

CRP-[a], Crpd, gp300, vomeroglandin, CRP-[b], ebnerin, MUCLIN, hensin

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.248) question?

Stock #

R9474 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

131032053-131121630 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 131074257 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 625 (R625H)

Ref Sequence

ENSEMBL: ENSMUSP00000146685 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084509] [ENSMUST00000124096] [ENSMUST00000208311] [ENSMUST00000213064]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000084509
AA Change: R614H

SMART Domains

Protein: ENSMUSP00000081556
Gene: ENSMUSG00000047517
AA Change: R614H

Domain	Start	End	E-Value	Type
SR	37	137	5.54e-59	SMART
SR	186	286	3.6e-58	SMART
SR	324	424	1.21e-59	SMART
SR	463	563	2.97e-59	SMART
SR	602	702	3.36e-58	SMART
SR	741	841	5.17e-59	SMART
low complexity region	848	879	N/A	INTRINSIC
CUB	884	993	4.22e-41	SMART
CUB	1000	1109	7.35e-41	SMART
CUB	1126	1235	3.73e-42	SMART
CUB	1242	1351	2.02e-38	SMART
SR	1371	1471	3.92e-59	SMART
low complexity region	1476	1488	N/A	INTRINSIC
CUB	1494	1603	6.7e-44	SMART
ZP	1612	1860	8.11e-74	SMART
transmembrane domain	1906	1928	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124096

SMART Domains

Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

Domain	Start	End	E-Value	Type
Pfam:Pkinase	1	118	4.8e-19	PFAM
Pfam:Pkinase_Tyr	1	118	1.7e-50	PFAM
low complexity region	146	160	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000208311
AA Change: R625H

Predicted Effect

probably benign
Transcript: ENSMUST00000213064

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Loss of sequences from human chromosome 10q has been associated with the progression of human cancers. This gene was originally isolated based on its deletion in a medulloblastoma cell line. This gene is expressed with transcripts of 6.0, 7.5, and 8.0 kb in fetal lung and with one transcript of 8.0 kb in adult lung, although the 7.5 kb transcript has not been characterized. The encoded protein precursor is a glycoprotein containing multiple scavenger receptor cysteine-rich (SRCR) domains separated by SRCR-interspersed domains (SID). Transcript variant 2 (8.0 kb) has been shown to bind surfactant protein D independently of carbohydrate recognition. This indicates that DMBT1 may not be a classical tumor suppressor gene, but rather play a role in the interaction of tumor cells and the immune system. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for one null allele display embryonic lethality and an abnormal inner cell mass. Mice homozygous for a different null allele are viable and fertile with an increased susceptibility to induced colitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610008E11Rik	C	A	10: 79,067,731	K250N	probably damaging	Het
9530077C05Rik	T	C	9: 22,431,719	M303T	probably damaging	Het
Adam5	A	T	8: 24,747,524	D623E	possibly damaging	Het
Akt3	T	C	1: 177,025,386	Y473C	probably damaging	Het
Ankib1	A	G	5: 3,755,617	Y217H	probably damaging	Het
Clca4b	T	A	3: 144,911,166	T908S	probably benign	Het
Clec7a	G	A	6: 129,463,163	Q160*	probably null	Het
Cntnap4	T	A	8: 112,733,471	I152N	probably damaging	Het
Ctdspl	C	T	9: 119,037,377	A179V	probably damaging	Het
Ddx43	T	C	9: 78,406,386	S200P	probably damaging	Het
Dip2c	A	G	13: 9,494,927	D84G	unknown	Het
Dusp9	TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG	TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG	X: 73,640,611		probably benign	Het
E2f7	C	T	10: 110,767,189	T355I	probably damaging	Het
E2f7	C	A	10: 110,779,057	L541M	probably damaging	Het
Elovl5	T	A	9: 77,982,725	S273T	possibly damaging	Het
Emc1	T	A	4: 139,366,394	L605Q	probably damaging	Het
Fras1	T	A	5: 96,739,265	D2635E	probably benign	Het
Gabrb1	G	A	5: 72,108,347	G195E	probably damaging	Het
Galm	A	G	17: 80,150,132	D199G	possibly damaging	Het
Galntl6	T	G	8: 57,777,325	S20R	probably damaging	Het
Gm21671	A	T	5: 25,953,138	I72N	probably damaging	Het
Grb14	T	G	2: 64,938,400	Y189S	probably damaging	Het
Hk2	T	A	6: 82,728,914	I803F	probably damaging	Het
Hmcn1	G	A	1: 150,630,720	R3779W	probably damaging	Het
Hmgcr	A	C	13: 96,659,895	M260R	probably damaging	Het
Hsbp1l1	T	A	18: 80,233,424	K68N	possibly damaging	Het
Inhba	A	C	13: 16,017,678	E128A	probably benign	Het
Itpr3	G	A	17: 27,118,677		probably benign	Het
Klhl3	G	A	13: 58,019,459	P364S	probably damaging	Het
Lhpp	T	C	7: 132,641,583	L176P	probably damaging	Het
Lrp1b	C	A	2: 40,601,587	A223S	probably damaging	Het
Lrp3	A	G	7: 35,204,064	F286L	probably damaging	Het
Lrrc7	T	C	3: 158,135,391	T1337A	probably benign	Het
Magi2	A	G	5: 20,195,021	D17G	probably benign	Het
Map3k21	T	C	8: 125,924,164	S302P	probably damaging	Het
Mbtd1	A	G	11: 93,925,685	D386G	probably benign	Het
Mfsd2b	A	T	12: 4,866,820	D306E	possibly damaging	Het
Muc20	T	C	16: 32,794,083	E308G	probably damaging	Het
Myh13	G	A	11: 67,364,886	S34N		Het
Nebl	C	A	2: 17,369,610	G894*	probably null	Het
Nelfa	A	G	5: 33,898,751	Y523H	probably damaging	Het
Ninj1	A	G	13: 49,187,600	D13G	probably benign	Het
Ninl	A	T	2: 150,940,806	S170T	probably benign	Het
Nlrp4c	G	A	7: 6,065,627	V176M	possibly damaging	Het
Nobox	G	A	6: 43,307,181	R144C	probably damaging	Het
Oas1a	G	A	5: 120,899,254	L237F	probably damaging	Het
Olfr1099	A	G	2: 86,959,413	M15T	probably benign	Het
Olfr1153	T	C	2: 87,896,349	M50T	probably benign	Het
Olfr1254	A	C	2: 89,789,162	Y63*	probably null	Het
Olfr1348	A	G	7: 6,502,151	L25P	probably benign	Het
Olfr1356	T	C	10: 78,847,057	N286S	probably damaging	Het
Olfr625-ps1	A	T	7: 103,683,270	Y184F	probably damaging	Het
Orai1	A	G	5: 123,029,238	N158S	probably damaging	Het
Pa2g4	C	A	10: 128,563,098	V121L	probably benign	Het
Pclo	T	C	5: 14,521,236	S212P	possibly damaging	Het
Plce1	G	A	19: 38,777,893	E2121K	possibly damaging	Het
Plg	A	G	17: 12,403,137	Y448C	probably damaging	Het
Plppr4	A	T	3: 117,323,217	N330K	probably damaging	Het
Pou2f2	A	G	7: 25,094,822	L373S	probably benign	Het
Rnpep	A	G	1: 135,283,603	F136L	probably benign	Het
Rp1	A	G	1: 4,092,615		probably null	Het
Shank1	G	A	7: 44,312,918	S71N	unknown	Het
Slc5a4a	GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC	GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC	10: 76,150,404		probably benign	Het
Slc5a5	T	C	8: 70,884,952	D574G	probably benign	Het
Slc7a15	T	A	12: 8,538,794	N251I	probably damaging	Het
Susd4	T	C	1: 182,892,100	S427P	probably benign	Het
Tarbp1	T	A	8: 126,429,040	T1320S	probably benign	Het
Tbpl2	C	T	2: 24,094,638	V166I	probably benign	Het
Thbs1	T	C	2: 118,120,037		probably null	Het
Tnfsf13b	A	G	8: 10,031,648	Y270C	probably damaging	Het
Vps11	G	T	9: 44,348,993	C857*	probably null	Het
Vsig10	G	A	5: 117,325,039	R110H	probably benign	Het
Wee2	T	A	6: 40,455,110	Y204*	probably null	Het
Zfpm2	T	A	15: 41,103,471	S1117R	probably damaging	Het
Zscan5b	A	G	7: 6,231,473	N166S	probably benign	Het

Other mutations in Dmbt1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Dmbt1	APN	7	131079540	intron	probably benign
IGL00161:Dmbt1	APN	7	131109628	missense	probably damaging	1.00
IGL00331:Dmbt1	APN	7	131099290	missense	possibly damaging	0.46
IGL00769:Dmbt1	APN	7	131082500	missense	probably damaging	0.99
IGL00792:Dmbt1	APN	7	131097607	missense	possibly damaging	0.66
IGL00823:Dmbt1	APN	7	131058158	missense	probably benign	0.26
IGL01072:Dmbt1	APN	7	131085368	splice site	probably benign
IGL01317:Dmbt1	APN	7	131041191	missense	probably damaging	1.00
IGL01335:Dmbt1	APN	7	131088767	missense	possibly damaging	0.95
IGL01372:Dmbt1	APN	7	131103679	missense	possibly damaging	0.90
IGL01511:Dmbt1	APN	7	131116728	missense	possibly damaging	0.49
IGL01627:Dmbt1	APN	7	131081185	missense	probably benign	0.14
IGL01890:Dmbt1	APN	7	131074419	intron	probably benign
IGL02160:Dmbt1	APN	7	131082688	missense	probably damaging	1.00
IGL02186:Dmbt1	APN	7	131093256	splice site	probably benign
IGL02197:Dmbt1	APN	7	131085422	splice site	probably benign
IGL02332:Dmbt1	APN	7	131066613	intron	probably benign
IGL02427:Dmbt1	APN	7	131088085	splice site	probably null
IGL02726:Dmbt1	APN	7	131074410	intron	probably benign
IGL02967:Dmbt1	APN	7	131071189	missense	possibly damaging	0.70
IGL03003:Dmbt1	APN	7	131082679	missense	probably benign	0.05
IGL03089:Dmbt1	APN	7	131111049	missense	probably damaging	0.99
cavity	UTSW	7	131112236	missense	unknown
lacunar	UTSW	7	131097631	missense	probably damaging	0.97
BB005:Dmbt1	UTSW	7	131037890	missense	probably benign	0.16
BB015:Dmbt1	UTSW	7	131037890	missense	probably benign	0.16
H8562:Dmbt1	UTSW	7	131112076	nonsense	probably null
K3955:Dmbt1	UTSW	7	131119564	missense	probably damaging	0.98
R0051:Dmbt1	UTSW	7	131119496	missense	possibly damaging	0.79
R0051:Dmbt1	UTSW	7	131119496	missense	possibly damaging	0.79
R0257:Dmbt1	UTSW	7	131106393	missense	probably damaging	1.00
R0388:Dmbt1	UTSW	7	131096049	splice site	probably benign
R0427:Dmbt1	UTSW	7	131040902	nonsense	probably null
R0478:Dmbt1	UTSW	7	131041187	missense	possibly damaging	0.93
R0502:Dmbt1	UTSW	7	131097673	splice site	probably null
R0538:Dmbt1	UTSW	7	131049901	splice site	probably benign
R0626:Dmbt1	UTSW	7	131102081	missense	probably damaging	0.97
R0631:Dmbt1	UTSW	7	131097653	missense	possibly damaging	0.90
R0948:Dmbt1	UTSW	7	131093117	missense	possibly damaging	0.95
R1169:Dmbt1	UTSW	7	131074524	critical splice donor site	probably null
R1413:Dmbt1	UTSW	7	131050214	missense	probably damaging	1.00
R1458:Dmbt1	UTSW	7	131044487	splice site	probably benign
R1463:Dmbt1	UTSW	7	131109637	critical splice donor site	probably null
R1509:Dmbt1	UTSW	7	131074331	intron	probably benign
R1990:Dmbt1	UTSW	7	131058288	missense	probably damaging	0.98
R2018:Dmbt1	UTSW	7	131110989	missense	possibly damaging	0.93
R2019:Dmbt1	UTSW	7	131110989	missense	possibly damaging	0.93
R2042:Dmbt1	UTSW	7	131106359	missense	probably damaging	0.99
R2056:Dmbt1	UTSW	7	131106170	missense	possibly damaging	0.80
R2057:Dmbt1	UTSW	7	131106170	missense	possibly damaging	0.80
R2058:Dmbt1	UTSW	7	131106170	missense	possibly damaging	0.80
R2059:Dmbt1	UTSW	7	131106170	missense	possibly damaging	0.80
R2061:Dmbt1	UTSW	7	131099133	missense	possibly damaging	0.66
R2092:Dmbt1	UTSW	7	131050018	missense	probably damaging	1.00
R2102:Dmbt1	UTSW	7	131102032	missense	probably damaging	0.97
R2155:Dmbt1	UTSW	7	131097575	missense	possibly damaging	0.66
R2243:Dmbt1	UTSW	7	131046562	missense	probably benign	0.03
R2256:Dmbt1	UTSW	7	131090494	missense	probably benign	0.01
R2391:Dmbt1	UTSW	7	131106468	missense	probably damaging	1.00
R2394:Dmbt1	UTSW	7	131094734	nonsense	probably null
R3014:Dmbt1	UTSW	7	131032097	intron	probably benign
R3155:Dmbt1	UTSW	7	131050157	nonsense	probably null
R3176:Dmbt1	UTSW	7	131088071	missense	probably benign	0.19
R3276:Dmbt1	UTSW	7	131088071	missense	probably benign	0.19
R3442:Dmbt1	UTSW	7	131106249	missense	probably damaging	1.00
R3807:Dmbt1	UTSW	7	131112090	missense	possibly damaging	0.77
R4060:Dmbt1	UTSW	7	131074202	intron	probably benign
R4396:Dmbt1	UTSW	7	131116632	missense	probably damaging	0.98
R4453:Dmbt1	UTSW	7	131040934	missense	probably damaging	1.00
R5001:Dmbt1	UTSW	7	131050012	missense	probably damaging	1.00
R5051:Dmbt1	UTSW	7	131094742	missense	probably benign	0.01
R5156:Dmbt1	UTSW	7	131097670	critical splice donor site	probably null
R5225:Dmbt1	UTSW	7	131094735	missense	possibly damaging	0.84
R5281:Dmbt1	UTSW	7	131082619	missense	probably damaging	1.00
R5308:Dmbt1	UTSW	7	131041021	missense	probably damaging	1.00
R5447:Dmbt1	UTSW	7	131119511	missense	probably damaging	0.99
R5467:Dmbt1	UTSW	7	131040993	missense	probably damaging	1.00
R5497:Dmbt1	UTSW	7	131063403	intron	probably benign
R5526:Dmbt1	UTSW	7	131041190	missense	probably damaging	1.00
R5554:Dmbt1	UTSW	7	131099300	nonsense	probably null
R5566:Dmbt1	UTSW	7	131106273	missense	probably damaging	1.00
R5595:Dmbt1	UTSW	7	131054067	missense	probably benign	0.17
R6154:Dmbt1	UTSW	7	131109641	splice site	probably null
R6188:Dmbt1	UTSW	7	131097631	missense	probably damaging	0.97
R6214:Dmbt1	UTSW	7	131066733	missense	possibly damaging	0.95
R6215:Dmbt1	UTSW	7	131066733	missense	possibly damaging	0.95
R6391:Dmbt1	UTSW	7	131058254	missense	probably damaging	1.00
R6397:Dmbt1	UTSW	7	131103578	missense	possibly damaging	0.46
R6436:Dmbt1	UTSW	7	131116641	missense	probably benign	0.01
R6603:Dmbt1	UTSW	7	131046510	splice site	probably null
R6719:Dmbt1	UTSW	7	131119603	missense	possibly damaging	0.83
R6781:Dmbt1	UTSW	7	131046561	missense	probably benign	0.16
R7148:Dmbt1	UTSW	7	131066734	nonsense	probably null
R7191:Dmbt1	UTSW	7	131044520	missense	unknown
R7269:Dmbt1	UTSW	7	131066621	missense	unknown
R7288:Dmbt1	UTSW	7	131083789	nonsense	probably null
R7296:Dmbt1	UTSW	7	131112132	missense	unknown
R7349:Dmbt1	UTSW	7	131041124	missense	unknown
R7386:Dmbt1	UTSW	7	131112236	missense	unknown
R7428:Dmbt1	UTSW	7	131108463	missense	possibly damaging	0.53
R7481:Dmbt1	UTSW	7	131079511	critical splice acceptor site	probably null
R7486:Dmbt1	UTSW	7	131066462	missense	unknown
R7513:Dmbt1	UTSW	7	131090512	missense	unknown
R7553:Dmbt1	UTSW	7	131104867	missense	unknown
R7567:Dmbt1	UTSW	7	131061363	splice site	probably null
R7584:Dmbt1	UTSW	7	131088751	nonsense	probably null
R7736:Dmbt1	UTSW	7	131116896	missense	unknown
R7758:Dmbt1	UTSW	7	131121197	missense	unknown
R7928:Dmbt1	UTSW	7	131037890	missense	probably benign	0.16
R8080:Dmbt1	UTSW	7	131088770	missense	unknown
R8098:Dmbt1	UTSW	7	131108459	nonsense	probably null
R8125:Dmbt1	UTSW	7	131099223	missense	unknown
R8177:Dmbt1	UTSW	7	131106432	missense	possibly damaging	0.46
R8350:Dmbt1	UTSW	7	131085417	critical splice donor site	probably null
R8366:Dmbt1	UTSW	7	131066600	missense	unknown
R8378:Dmbt1	UTSW	7	131106465	missense	probably damaging	0.96
R8399:Dmbt1	UTSW	7	131082587	missense	unknown
R8400:Dmbt1	UTSW	7	131082587	missense	unknown
R8445:Dmbt1	UTSW	7	131090380	missense	unknown
R8450:Dmbt1	UTSW	7	131085417	critical splice donor site	probably null
R8511:Dmbt1	UTSW	7	131102012	missense	unknown
R8688:Dmbt1	UTSW	7	131058254	missense	unknown
R8850:Dmbt1	UTSW	7	131090404	missense	unknown
R8852:Dmbt1	UTSW	7	131041123	missense	unknown
R8871:Dmbt1	UTSW	7	131116868	missense	unknown
R8943:Dmbt1	UTSW	7	131119643	missense	possibly damaging	0.68
R8978:Dmbt1	UTSW	7	131037881	missense	possibly damaging	0.53
R9004:Dmbt1	UTSW	7	131112069	missense	unknown
R9020:Dmbt1	UTSW	7	131111058	missense	possibly damaging	0.86
R9088:Dmbt1	UTSW	7	131116689	missense	unknown
R9230:Dmbt1	UTSW	7	131037912	missense	probably benign	0.01
R9304:Dmbt1	UTSW	7	131099125	missense	unknown
R9377:Dmbt1	UTSW	7	131093102	missense	unknown
R9428:Dmbt1	UTSW	7	131066478	missense	unknown
R9573:Dmbt1	UTSW	7	131056180	critical splice donor site	probably null
R9675:Dmbt1	UTSW	7	131110923	missense	probably damaging	0.98
R9689:Dmbt1	UTSW	7	131058285	missense	unknown
R9781:Dmbt1	UTSW	7	131037869	missense	probably benign	0.00
X0024:Dmbt1	UTSW	7	131112248	nonsense	probably null
X0062:Dmbt1	UTSW	7	131094851	missense	possibly damaging	0.81
Z1176:Dmbt1	UTSW	7	131088812	missense	unknown
Z1177:Dmbt1	UTSW	7	131082485	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- AGCAGCAGGAGTTATTCATATCC -3'
(R):5'- AGTTATGAGAGAGCCAGCCTC -3'

Sequencing Primer
(F):5'- ATCCCATATTGTTCATGAGTGAGTG -3'
(R):5'- GATAGTCCTCATAGCCTCCACAGG -3'

Posted On

2022-06-15