Mutagenetix > Incidental Mutation

Incidental Mutation 'R9474:Slc5a5'

715646

Institutional Source

Beutler Lab

Gene Symbol

Slc5a5

Ensembl Gene

ENSMUSG00000000792

Gene Name

solute carrier family 5 (sodium iodide symporter), member 5

Synonyms

NIS

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9474 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

70882889-70892757 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 70884952 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 574 (D574G)

Ref Sequence

ENSEMBL: ENSMUSP00000000809 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000809]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000000809
AA Change: D574G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000000809
Gene: ENSMUSG00000000792
AA Change: D574G

Domain	Start	End	E-Value	Type
Pfam:SSF	47	452	2.5e-43	PFAM
transmembrane domain	522	544	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium glucose cotransporter family. The encoded protein is responsible for the uptake of iodine in tissues such as the thyroid and lactating breast tissue. The iodine taken up by the thyroid is incorporated into the metabolic regulators triiodothyronine (T3) and tetraiodothyronine (T4). Mutations in this gene are associated with thyroid dyshormonogenesis 1.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced T3 and T4 levels when fed a minimal iodine diet. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610008E11Rik	C	A	10: 79,067,731	K250N	probably damaging	Het
9530077C05Rik	T	C	9: 22,431,719	M303T	probably damaging	Het
Adam5	A	T	8: 24,747,524	D623E	possibly damaging	Het
Akt3	T	C	1: 177,025,386	Y473C	probably damaging	Het
Ankib1	A	G	5: 3,755,617	Y217H	probably damaging	Het
Clca4b	T	A	3: 144,911,166	T908S	probably benign	Het
Clec7a	G	A	6: 129,463,163	Q160*	probably null	Het
Cntnap4	T	A	8: 112,733,471	I152N	probably damaging	Het
Ctdspl	C	T	9: 119,037,377	A179V	probably damaging	Het
Ddx43	T	C	9: 78,406,386	S200P	probably damaging	Het
Dip2c	A	G	13: 9,494,927	D84G	unknown	Het
Dmbt1	G	A	7: 131,074,257	R625H	unknown	Het
Dusp9	TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG	TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG	X: 73,640,611		probably benign	Het
E2f7	C	T	10: 110,767,189	T355I	probably damaging	Het
E2f7	C	A	10: 110,779,057	L541M	probably damaging	Het
Elovl5	T	A	9: 77,982,725	S273T	possibly damaging	Het
Emc1	T	A	4: 139,366,394	L605Q	probably damaging	Het
Fras1	T	A	5: 96,739,265	D2635E	probably benign	Het
Gabrb1	G	A	5: 72,108,347	G195E	probably damaging	Het
Galm	A	G	17: 80,150,132	D199G	possibly damaging	Het
Galntl6	T	G	8: 57,777,325	S20R	probably damaging	Het
Gm21671	A	T	5: 25,953,138	I72N	probably damaging	Het
Grb14	T	G	2: 64,938,400	Y189S	probably damaging	Het
Hk2	T	A	6: 82,728,914	I803F	probably damaging	Het
Hmcn1	G	A	1: 150,630,720	R3779W	probably damaging	Het
Hmgcr	A	C	13: 96,659,895	M260R	probably damaging	Het
Hsbp1l1	T	A	18: 80,233,424	K68N	possibly damaging	Het
Inhba	A	C	13: 16,017,678	E128A	probably benign	Het
Itpr3	G	A	17: 27,118,677		probably benign	Het
Klhl3	G	A	13: 58,019,459	P364S	probably damaging	Het
Lhpp	T	C	7: 132,641,583	L176P	probably damaging	Het
Lrp1b	C	A	2: 40,601,587	A223S	probably damaging	Het
Lrp3	A	G	7: 35,204,064	F286L	probably damaging	Het
Lrrc7	T	C	3: 158,135,391	T1337A	probably benign	Het
Magi2	A	G	5: 20,195,021	D17G	probably benign	Het
Map3k21	T	C	8: 125,924,164	S302P	probably damaging	Het
Mbtd1	A	G	11: 93,925,685	D386G	probably benign	Het
Mfsd2b	A	T	12: 4,866,820	D306E	possibly damaging	Het
Muc20	T	C	16: 32,794,083	E308G	probably damaging	Het
Myh13	G	A	11: 67,364,886	S34N		Het
Nebl	C	A	2: 17,369,610	G894*	probably null	Het
Nelfa	A	G	5: 33,898,751	Y523H	probably damaging	Het
Ninj1	A	G	13: 49,187,600	D13G	probably benign	Het
Ninl	A	T	2: 150,940,806	S170T	probably benign	Het
Nlrp4c	G	A	7: 6,065,627	V176M	possibly damaging	Het
Nobox	G	A	6: 43,307,181	R144C	probably damaging	Het
Oas1a	G	A	5: 120,899,254	L237F	probably damaging	Het
Olfr1099	A	G	2: 86,959,413	M15T	probably benign	Het
Olfr1153	T	C	2: 87,896,349	M50T	probably benign	Het
Olfr1254	A	C	2: 89,789,162	Y63*	probably null	Het
Olfr1348	A	G	7: 6,502,151	L25P	probably benign	Het
Olfr1356	T	C	10: 78,847,057	N286S	probably damaging	Het
Olfr625-ps1	A	T	7: 103,683,270	Y184F	probably damaging	Het
Orai1	A	G	5: 123,029,238	N158S	probably damaging	Het
Pa2g4	C	A	10: 128,563,098	V121L	probably benign	Het
Pclo	T	C	5: 14,521,236	S212P	possibly damaging	Het
Plce1	G	A	19: 38,777,893	E2121K	possibly damaging	Het
Plg	A	G	17: 12,403,137	Y448C	probably damaging	Het
Plppr4	A	T	3: 117,323,217	N330K	probably damaging	Het
Pou2f2	A	G	7: 25,094,822	L373S	probably benign	Het
Rnpep	A	G	1: 135,283,603	F136L	probably benign	Het
Rp1	A	G	1: 4,092,615		probably null	Het
Shank1	G	A	7: 44,312,918	S71N	unknown	Het
Slc5a4a	GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC	GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC	10: 76,150,404		probably benign	Het
Slc7a15	T	A	12: 8,538,794	N251I	probably damaging	Het
Susd4	T	C	1: 182,892,100	S427P	probably benign	Het
Tarbp1	T	A	8: 126,429,040	T1320S	probably benign	Het
Tbpl2	C	T	2: 24,094,638	V166I	probably benign	Het
Thbs1	T	C	2: 118,120,037		probably null	Het
Tnfsf13b	A	G	8: 10,031,648	Y270C	probably damaging	Het
Vps11	G	T	9: 44,348,993	C857*	probably null	Het
Vsig10	G	A	5: 117,325,039	R110H	probably benign	Het
Wee2	T	A	6: 40,455,110	Y204*	probably null	Het
Zfpm2	T	A	15: 41,103,471	S1117R	probably damaging	Het
Zscan5b	A	G	7: 6,231,473	N166S	probably benign	Het

Other mutations in Slc5a5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00766:Slc5a5	APN	8	70888537	missense	probably damaging	0.99
IGL01372:Slc5a5	APN	8	70890376	unclassified	probably benign
IGL01394:Slc5a5	APN	8	70889388	nonsense	probably null
IGL01571:Slc5a5	APN	8	70891332	unclassified	probably benign
IGL02043:Slc5a5	APN	8	70892429	missense	possibly damaging	0.84
IGL02186:Slc5a5	APN	8	70886120	missense	possibly damaging	0.79
IGL02479:Slc5a5	APN	8	70888911	missense	possibly damaging	0.67
IGL02559:Slc5a5	APN	8	70890271	missense	probably damaging	1.00
IGL02892:Slc5a5	APN	8	70892517	missense	probably damaging	1.00
IGL03388:Slc5a5	APN	8	70890328	missense	probably benign	0.45
R0234:Slc5a5	UTSW	8	70889633	missense	probably damaging	1.00
R0234:Slc5a5	UTSW	8	70889633	missense	probably damaging	1.00
R0413:Slc5a5	UTSW	8	70891675	missense	possibly damaging	0.63
R0662:Slc5a5	UTSW	8	70883875	missense	probably benign	0.01
R0781:Slc5a5	UTSW	8	70890220	missense	probably benign	0.19
R1061:Slc5a5	UTSW	8	70890221	missense	probably benign	0.00
R1400:Slc5a5	UTSW	8	70889435	missense	possibly damaging	0.87
R1524:Slc5a5	UTSW	8	70892334	missense	probably damaging	1.00
R2033:Slc5a5	UTSW	8	70888587	missense	probably damaging	0.99
R2072:Slc5a5	UTSW	8	70892439	missense	possibly damaging	0.95
R2075:Slc5a5	UTSW	8	70892439	missense	possibly damaging	0.95
R2110:Slc5a5	UTSW	8	70889751	splice site	probably null
R2111:Slc5a5	UTSW	8	70889751	splice site	probably null
R2112:Slc5a5	UTSW	8	70889751	splice site	probably null
R2201:Slc5a5	UTSW	8	70892458	missense	probably damaging	0.98
R3978:Slc5a5	UTSW	8	70889395	missense	probably benign	0.00
R4244:Slc5a5	UTSW	8	70890286	missense	probably benign
R5161:Slc5a5	UTSW	8	70888848	missense	probably damaging	1.00
R5397:Slc5a5	UTSW	8	70891179	missense	probably damaging	1.00
R5718:Slc5a5	UTSW	8	70887755	missense	probably benign	0.00
R5740:Slc5a5	UTSW	8	70888917	splice site	probably null
R5869:Slc5a5	UTSW	8	70892330	missense	probably damaging	1.00
R6268:Slc5a5	UTSW	8	70888620	missense	probably damaging	1.00
R6290:Slc5a5	UTSW	8	70891178	missense	probably damaging	1.00
R6292:Slc5a5	UTSW	8	70891178	missense	probably damaging	1.00
R7098:Slc5a5	UTSW	8	70888538	missense	probably damaging	0.99
R7354:Slc5a5	UTSW	8	70889603	missense	probably damaging	1.00
R8777:Slc5a5	UTSW	8	70891290	missense	possibly damaging	0.87
R8777-TAIL:Slc5a5	UTSW	8	70891290	missense	possibly damaging	0.87
R8903:Slc5a5	UTSW	8	70892583	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAGGTGACAGTGTCTCCAAC -3'
(R):5'- CTCCTCACGATTCAGATGAAGC -3'

Sequencing Primer
(F):5'- AGGTGACAGTGTCTCCAACTTTCAG -3'
(R):5'- TCACGATTCAGATGAAGCAACTG -3'

Posted On

2022-06-15