Incidental Mutation 'R9474:Myh13'
ID 715661
Institutional Source Beutler Lab
Gene Symbol Myh13
Ensembl Gene ENSMUSG00000060180
Gene Name myosin, heavy polypeptide 13, skeletal muscle
Synonyms EO Myosin, extraocular myosin, MyHC-eo
Accession Numbers

Genbank: NM_001081250; MGI: 1339967

Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock # R9474 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 67321658-67371586 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 67364886 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 34 (S34N)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081911] [ENSMUST00000108684] [ENSMUST00000180845]
AlphaFold B1AR69
Predicted Effect probably benign
Transcript: ENSMUST00000081911
AA Change: S1667N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000080584
Gene: ENSMUSG00000060180
AA Change: S1667N

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 8e-13 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
Pfam:Myosin_tail_1 847 1928 4.6e-159 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108684
AA Change: S1667N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000104324
Gene: ENSMUSG00000060180
AA Change: S1667N

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.8e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
low complexity region 847 858 N/A INTRINSIC
low complexity region 925 940 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180845
AA Change: S1667N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000137731
Gene: ENSMUSG00000060180
AA Change: S1667N

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.8e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
low complexity region 847 858 N/A INTRINSIC
low complexity region 925 940 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik C A 10: 79,067,731 K250N probably damaging Het
9530077C05Rik T C 9: 22,431,719 M303T probably damaging Het
Adam5 A T 8: 24,747,524 D623E possibly damaging Het
Akt3 T C 1: 177,025,386 Y473C probably damaging Het
Ankib1 A G 5: 3,755,617 Y217H probably damaging Het
Clca4b T A 3: 144,911,166 T908S probably benign Het
Clec7a G A 6: 129,463,163 Q160* probably null Het
Cntnap4 T A 8: 112,733,471 I152N probably damaging Het
Ctdspl C T 9: 119,037,377 A179V probably damaging Het
Ddx43 T C 9: 78,406,386 S200P probably damaging Het
Dip2c A G 13: 9,494,927 D84G unknown Het
Dmbt1 G A 7: 131,074,257 R625H unknown Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
E2f7 C T 10: 110,767,189 T355I probably damaging Het
E2f7 C A 10: 110,779,057 L541M probably damaging Het
Elovl5 T A 9: 77,982,725 S273T possibly damaging Het
Emc1 T A 4: 139,366,394 L605Q probably damaging Het
Fras1 T A 5: 96,739,265 D2635E probably benign Het
Gabrb1 G A 5: 72,108,347 G195E probably damaging Het
Galm A G 17: 80,150,132 D199G possibly damaging Het
Galntl6 T G 8: 57,777,325 S20R probably damaging Het
Gm21671 A T 5: 25,953,138 I72N probably damaging Het
Grb14 T G 2: 64,938,400 Y189S probably damaging Het
Hk2 T A 6: 82,728,914 I803F probably damaging Het
Hmcn1 G A 1: 150,630,720 R3779W probably damaging Het
Hmgcr A C 13: 96,659,895 M260R probably damaging Het
Hsbp1l1 T A 18: 80,233,424 K68N possibly damaging Het
Inhba A C 13: 16,017,678 E128A probably benign Het
Itpr3 G A 17: 27,118,677 probably benign Het
Klhl3 G A 13: 58,019,459 P364S probably damaging Het
Lhpp T C 7: 132,641,583 L176P probably damaging Het
Lrp1b C A 2: 40,601,587 A223S probably damaging Het
Lrp3 A G 7: 35,204,064 F286L probably damaging Het
Lrrc7 T C 3: 158,135,391 T1337A probably benign Het
Magi2 A G 5: 20,195,021 D17G probably benign Het
Map3k21 T C 8: 125,924,164 S302P probably damaging Het
Mbtd1 A G 11: 93,925,685 D386G probably benign Het
Mfsd2b A T 12: 4,866,820 D306E possibly damaging Het
Muc20 T C 16: 32,794,083 E308G probably damaging Het
Nebl C A 2: 17,369,610 G894* probably null Het
Nelfa A G 5: 33,898,751 Y523H probably damaging Het
Ninj1 A G 13: 49,187,600 D13G probably benign Het
Ninl A T 2: 150,940,806 S170T probably benign Het
Nlrp4c G A 7: 6,065,627 V176M possibly damaging Het
Nobox G A 6: 43,307,181 R144C probably damaging Het
Oas1a G A 5: 120,899,254 L237F probably damaging Het
Olfr1099 A G 2: 86,959,413 M15T probably benign Het
Olfr1153 T C 2: 87,896,349 M50T probably benign Het
Olfr1254 A C 2: 89,789,162 Y63* probably null Het
Olfr1348 A G 7: 6,502,151 L25P probably benign Het
Olfr1356 T C 10: 78,847,057 N286S probably damaging Het
Olfr625-ps1 A T 7: 103,683,270 Y184F probably damaging Het
Orai1 A G 5: 123,029,238 N158S probably damaging Het
Pa2g4 C A 10: 128,563,098 V121L probably benign Het
Pclo T C 5: 14,521,236 S212P possibly damaging Het
Plce1 G A 19: 38,777,893 E2121K possibly damaging Het
Plg A G 17: 12,403,137 Y448C probably damaging Het
Plppr4 A T 3: 117,323,217 N330K probably damaging Het
Pou2f2 A G 7: 25,094,822 L373S probably benign Het
Rnpep A G 1: 135,283,603 F136L probably benign Het
Rp1 A G 1: 4,092,615 probably null Het
Shank1 G A 7: 44,312,918 S71N unknown Het
Slc5a4a GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC 10: 76,150,404 probably benign Het
Slc5a5 T C 8: 70,884,952 D574G probably benign Het
Slc7a15 T A 12: 8,538,794 N251I probably damaging Het
Susd4 T C 1: 182,892,100 S427P probably benign Het
Tarbp1 T A 8: 126,429,040 T1320S probably benign Het
Tbpl2 C T 2: 24,094,638 V166I probably benign Het
Thbs1 T C 2: 118,120,037 probably null Het
Tnfsf13b A G 8: 10,031,648 Y270C probably damaging Het
Vps11 G T 9: 44,348,993 C857* probably null Het
Vsig10 G A 5: 117,325,039 R110H probably benign Het
Wee2 T A 6: 40,455,110 Y204* probably null Het
Zfpm2 T A 15: 41,103,471 S1117R probably damaging Het
Zscan5b A G 7: 6,231,473 N166S probably benign Het
Other mutations in Myh13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Myh13 APN 11 67342488 missense probably damaging 1.00
IGL00808:Myh13 APN 11 67335004 critical splice donor site probably null
IGL00822:Myh13 APN 11 67361328 missense probably damaging 0.98
IGL00823:Myh13 APN 11 67355947 missense probably benign 0.00
IGL00945:Myh13 APN 11 67348006 missense probably null 1.00
IGL01414:Myh13 APN 11 67342472 missense probably benign 0.02
IGL01482:Myh13 APN 11 67352068 missense probably benign
IGL01523:Myh13 APN 11 67347943 missense possibly damaging 0.73
IGL01723:Myh13 APN 11 67369219 unclassified probably benign
IGL01997:Myh13 APN 11 67367166 missense probably benign 0.14
IGL02369:Myh13 APN 11 67360274 unclassified probably benign
IGL02478:Myh13 APN 11 67369378 missense probably benign
IGL02663:Myh13 APN 11 67354927 nonsense probably null
IGL02851:Myh13 APN 11 67348916 missense possibly damaging 0.92
IGL02863:Myh13 APN 11 67332541 missense probably damaging 1.00
IGL02929:Myh13 APN 11 67367165 missense probably damaging 1.00
IGL02979:Myh13 APN 11 67334962 missense possibly damaging 0.72
IGL03065:Myh13 APN 11 67344853 missense probably damaging 0.99
IGL03214:Myh13 APN 11 67353585 missense possibly damaging 0.79
IGL03223:Myh13 APN 11 67350242 missense probably benign 0.39
IGL03231:Myh13 APN 11 67351991 missense possibly damaging 0.94
IGL03407:Myh13 APN 11 67352152 missense probably damaging 1.00
3-1:Myh13 UTSW 11 67351951 splice site probably benign
P0042:Myh13 UTSW 11 67334991 missense probably benign 0.00
R0047:Myh13 UTSW 11 67367237 missense probably benign 0.00
R0047:Myh13 UTSW 11 67367237 missense probably benign 0.00
R0379:Myh13 UTSW 11 67369295 unclassified probably benign
R0496:Myh13 UTSW 11 67348815 missense probably damaging 1.00
R0584:Myh13 UTSW 11 67360374 nonsense probably null
R0595:Myh13 UTSW 11 67344846 missense probably benign 0.03
R0621:Myh13 UTSW 11 67341232 missense probably damaging 0.98
R0834:Myh13 UTSW 11 67349610 missense possibly damaging 0.88
R0893:Myh13 UTSW 11 67334601 missense probably damaging 1.00
R0964:Myh13 UTSW 11 67345002 missense probably benign 0.02
R0973:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R0973:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R0974:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R1028:Myh13 UTSW 11 67356181 missense possibly damaging 0.71
R1112:Myh13 UTSW 11 67354750 missense probably damaging 1.00
R1283:Myh13 UTSW 11 67370921 missense probably damaging 1.00
R1288:Myh13 UTSW 11 67353718 missense probably benign 0.00
R1386:Myh13 UTSW 11 67370950 missense possibly damaging 0.79
R1457:Myh13 UTSW 11 67331046 missense probably damaging 0.97
R1503:Myh13 UTSW 11 67353674 missense probably benign 0.43
R1574:Myh13 UTSW 11 67362581 unclassified probably benign
R1673:Myh13 UTSW 11 67352119 missense possibly damaging 0.79
R1693:Myh13 UTSW 11 67341484 missense possibly damaging 0.95
R1763:Myh13 UTSW 11 67334576 missense probably benign
R2029:Myh13 UTSW 11 67361289 missense probably benign 0.03
R2030:Myh13 UTSW 11 67350238 missense probably benign
R2247:Myh13 UTSW 11 67334558 missense probably damaging 0.96
R2393:Myh13 UTSW 11 67340358 missense possibly damaging 0.93
R2395:Myh13 UTSW 11 67364922 missense probably benign 0.12
R2884:Myh13 UTSW 11 67337643 missense probably benign 0.27
R3696:Myh13 UTSW 11 67345044 missense possibly damaging 0.55
R3786:Myh13 UTSW 11 67327188 missense probably benign 0.01
R3875:Myh13 UTSW 11 67358194 missense probably benign 0.26
R3918:Myh13 UTSW 11 67329238 missense probably benign 0.00
R4061:Myh13 UTSW 11 67330889 missense possibly damaging 0.71
R4160:Myh13 UTSW 11 67364810 intron probably benign
R4183:Myh13 UTSW 11 67349610 missense possibly damaging 0.88
R4392:Myh13 UTSW 11 67344881 splice site probably null
R4639:Myh13 UTSW 11 67341551 missense possibly damaging 0.91
R4670:Myh13 UTSW 11 67364738 nonsense probably null
R4783:Myh13 UTSW 11 67341270 missense probably damaging 1.00
R4877:Myh13 UTSW 11 67337651 missense probably damaging 0.99
R5250:Myh13 UTSW 11 67327259 nonsense probably null
R5278:Myh13 UTSW 11 67334564 missense probably benign 0.00
R5371:Myh13 UTSW 11 67344790 splice site probably null
R5479:Myh13 UTSW 11 67348822 missense probably damaging 0.97
R5510:Myh13 UTSW 11 67337723 missense probably benign 0.05
R5690:Myh13 UTSW 11 67329275 missense probably damaging 1.00
R5797:Myh13 UTSW 11 67335002 missense possibly damaging 0.66
R5823:Myh13 UTSW 11 67360468 missense probably damaging 1.00
R5877:Myh13 UTSW 11 67353658 missense possibly damaging 0.78
R6041:Myh13 UTSW 11 67364730 missense probably damaging 1.00
R6175:Myh13 UTSW 11 67354762 missense probably benign 0.00
R6244:Myh13 UTSW 11 67362501 missense probably benign 0.00
R6454:Myh13 UTSW 11 67350365 missense probably benign 0.03
R6617:Myh13 UTSW 11 67361400 missense probably benign 0.00
R6707:Myh13 UTSW 11 67350260 missense probably damaging 1.00
R6747:Myh13 UTSW 11 67350419 missense probably damaging 0.99
R6823:Myh13 UTSW 11 67356158 missense probably benign
R6911:Myh13 UTSW 11 67354927 nonsense probably null
R6997:Myh13 UTSW 11 67327154 nonsense probably null
R7033:Myh13 UTSW 11 67369316 missense possibly damaging 0.92
R7145:Myh13 UTSW 11 67354740 missense probably benign 0.08
R7232:Myh13 UTSW 11 67348846 missense probably damaging 1.00
R7428:Myh13 UTSW 11 67332564 missense probably damaging 1.00
R7448:Myh13 UTSW 11 67364460 critical splice acceptor site probably null
R7474:Myh13 UTSW 11 67327164 missense possibly damaging 0.93
R7474:Myh13 UTSW 11 67367711 missense
R7766:Myh13 UTSW 11 67358329 missense probably benign 0.37
R7809:Myh13 UTSW 11 67350341 missense probably benign 0.14
R7813:Myh13 UTSW 11 67327230 missense probably benign 0.27
R7953:Myh13 UTSW 11 67340380 missense probably damaging 1.00
R8085:Myh13 UTSW 11 67334787 missense probably benign 0.00
R8397:Myh13 UTSW 11 67350287 missense possibly damaging 0.62
R8434:Myh13 UTSW 11 67363185 critical splice acceptor site probably null
R8490:Myh13 UTSW 11 67364525 missense probably damaging 0.98
R8676:Myh13 UTSW 11 67342485 missense probably damaging 1.00
R8681:Myh13 UTSW 11 67352134 missense possibly damaging 0.49
R8777:Myh13 UTSW 11 67361335 missense possibly damaging 0.92
R8777-TAIL:Myh13 UTSW 11 67361335 missense possibly damaging 0.92
R8965:Myh13 UTSW 11 67364606 missense probably benign 0.00
R9088:Myh13 UTSW 11 67352059 missense probably damaging 1.00
R9151:Myh13 UTSW 11 67361323 missense probably damaging 1.00
R9154:Myh13 UTSW 11 67362492 missense probably benign
R9182:Myh13 UTSW 11 67337753 missense probably damaging 1.00
R9332:Myh13 UTSW 11 67363283 missense possibly damaging 0.57
R9393:Myh13 UTSW 11 67352068 missense probably benign
R9446:Myh13 UTSW 11 67364499 missense probably benign 0.01
Z1176:Myh13 UTSW 11 67329295 missense possibly damaging 0.93
Z1177:Myh13 UTSW 11 67350452 missense possibly damaging 0.55
Z1177:Myh13 UTSW 11 67364591 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGGAGGGTGATCTCAACGAG -3'
(R):5'- CTGAGTTGAGGAGGCAGCATAC -3'

Sequencing Primer
(F):5'- AGATTCAGCTGAGCCATGC -3'
(R):5'- CAGCATACCTGGGAATGGAGC -3'
Posted On 2022-06-15