Mutagenetix > Incidental Mutation

Incidental Mutation 'R9474:Dip2c'

715665

Institutional Source

Beutler Lab

Gene Symbol

Dip2c

Ensembl Gene

ENSMUSG00000048264

Gene Name

disco interacting protein 2 homolog C

Synonyms

2900024P20Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.625) question?

Stock #

R9474 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

9276528-9668928 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 9494927 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 84 (D84G)

Ref Sequence

ENSEMBL: ENSMUSP00000131238 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166299] [ENSMUST00000169960] [ENSMUST00000174552]

AlphaFold

E9PWR4

Predicted Effect

probably benign
Transcript: ENSMUST00000166299

SMART Domains

Protein: ENSMUSP00000126827
Gene: ENSMUSG00000048264

Domain	Start	End	E-Value	Type
DMAP_binding	7	120	3.55e-43	SMART
low complexity region	170	187	N/A	INTRINSIC
low complexity region	275	287	N/A	INTRINSIC
Pfam:AMP-binding	324	801	3.6e-23	PFAM
Pfam:AMP-binding	977	1451	1.5e-72	PFAM
low complexity region	1514	1526	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000169960
AA Change: D84G

SMART Domains

Protein: ENSMUSP00000131238
Gene: ENSMUSG00000048264
AA Change: D84G

Domain	Start	End	E-Value	Type
DMAP_binding	7	176	3.02e-37	SMART
low complexity region	226	243	N/A	INTRINSIC
low complexity region	331	343	N/A	INTRINSIC
Pfam:AMP-binding	380	637	5.9e-10	PFAM
SCOP:d1lci__	675	875	2e-8	SMART
Pfam:AMP-binding	947	1421	1.2e-56	PFAM
low complexity region	1484	1496	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000174552

SMART Domains

Protein: ENSMUSP00000133806
Gene: ENSMUSG00000048264

Domain	Start	End	E-Value	Type
DMAP_binding	7	120	3.55e-43	SMART
low complexity region	170	187	N/A	INTRINSIC
low complexity region	275	287	N/A	INTRINSIC
Pfam:AMP-binding	324	800	2.7e-20	PFAM
Pfam:AMP-binding	976	1450	1.3e-56	PFAM
low complexity region	1513	1525	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 family. The protein shares strong similarity with a Drosophila protein which interacts with the transcription factor disco and is expressed in the nervous system. [provided by RefSeq, Oct 2008]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610008E11Rik	C	A	10: 79,067,731	K250N	probably damaging	Het
9530077C05Rik	T	C	9: 22,431,719	M303T	probably damaging	Het
Adam5	A	T	8: 24,747,524	D623E	possibly damaging	Het
Akt3	T	C	1: 177,025,386	Y473C	probably damaging	Het
Ankib1	A	G	5: 3,755,617	Y217H	probably damaging	Het
Clca4b	T	A	3: 144,911,166	T908S	probably benign	Het
Clec7a	G	A	6: 129,463,163	Q160*	probably null	Het
Cntnap4	T	A	8: 112,733,471	I152N	probably damaging	Het
Ctdspl	C	T	9: 119,037,377	A179V	probably damaging	Het
Ddx43	T	C	9: 78,406,386	S200P	probably damaging	Het
Dmbt1	G	A	7: 131,074,257	R625H	unknown	Het
Dusp9	TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG	TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG	X: 73,640,611		probably benign	Het
E2f7	C	T	10: 110,767,189	T355I	probably damaging	Het
E2f7	C	A	10: 110,779,057	L541M	probably damaging	Het
Elovl5	T	A	9: 77,982,725	S273T	possibly damaging	Het
Emc1	T	A	4: 139,366,394	L605Q	probably damaging	Het
Fras1	T	A	5: 96,739,265	D2635E	probably benign	Het
Gabrb1	G	A	5: 72,108,347	G195E	probably damaging	Het
Galm	A	G	17: 80,150,132	D199G	possibly damaging	Het
Galntl6	T	G	8: 57,777,325	S20R	probably damaging	Het
Gm21671	A	T	5: 25,953,138	I72N	probably damaging	Het
Grb14	T	G	2: 64,938,400	Y189S	probably damaging	Het
Hk2	T	A	6: 82,728,914	I803F	probably damaging	Het
Hmcn1	G	A	1: 150,630,720	R3779W	probably damaging	Het
Hmgcr	A	C	13: 96,659,895	M260R	probably damaging	Het
Hsbp1l1	T	A	18: 80,233,424	K68N	possibly damaging	Het
Inhba	A	C	13: 16,017,678	E128A	probably benign	Het
Itpr3	G	A	17: 27,118,677		probably benign	Het
Klhl3	G	A	13: 58,019,459	P364S	probably damaging	Het
Lhpp	T	C	7: 132,641,583	L176P	probably damaging	Het
Lrp1b	C	A	2: 40,601,587	A223S	probably damaging	Het
Lrp3	A	G	7: 35,204,064	F286L	probably damaging	Het
Lrrc7	T	C	3: 158,135,391	T1337A	probably benign	Het
Magi2	A	G	5: 20,195,021	D17G	probably benign	Het
Map3k21	T	C	8: 125,924,164	S302P	probably damaging	Het
Mbtd1	A	G	11: 93,925,685	D386G	probably benign	Het
Mfsd2b	A	T	12: 4,866,820	D306E	possibly damaging	Het
Muc20	T	C	16: 32,794,083	E308G	probably damaging	Het
Myh13	G	A	11: 67,364,886	S34N		Het
Nebl	C	A	2: 17,369,610	G894*	probably null	Het
Nelfa	A	G	5: 33,898,751	Y523H	probably damaging	Het
Ninj1	A	G	13: 49,187,600	D13G	probably benign	Het
Ninl	A	T	2: 150,940,806	S170T	probably benign	Het
Nlrp4c	G	A	7: 6,065,627	V176M	possibly damaging	Het
Nobox	G	A	6: 43,307,181	R144C	probably damaging	Het
Oas1a	G	A	5: 120,899,254	L237F	probably damaging	Het
Olfr1099	A	G	2: 86,959,413	M15T	probably benign	Het
Olfr1153	T	C	2: 87,896,349	M50T	probably benign	Het
Olfr1254	A	C	2: 89,789,162	Y63*	probably null	Het
Olfr1348	A	G	7: 6,502,151	L25P	probably benign	Het
Olfr1356	T	C	10: 78,847,057	N286S	probably damaging	Het
Olfr625-ps1	A	T	7: 103,683,270	Y184F	probably damaging	Het
Orai1	A	G	5: 123,029,238	N158S	probably damaging	Het
Pa2g4	C	A	10: 128,563,098	V121L	probably benign	Het
Pclo	T	C	5: 14,521,236	S212P	possibly damaging	Het
Plce1	G	A	19: 38,777,893	E2121K	possibly damaging	Het
Plg	A	G	17: 12,403,137	Y448C	probably damaging	Het
Plppr4	A	T	3: 117,323,217	N330K	probably damaging	Het
Pou2f2	A	G	7: 25,094,822	L373S	probably benign	Het
Rnpep	A	G	1: 135,283,603	F136L	probably benign	Het
Rp1	A	G	1: 4,092,615		probably null	Het
Shank1	G	A	7: 44,312,918	S71N	unknown	Het
Slc5a4a	GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC	GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC	10: 76,150,404		probably benign	Het
Slc5a5	T	C	8: 70,884,952	D574G	probably benign	Het
Slc7a15	T	A	12: 8,538,794	N251I	probably damaging	Het
Susd4	T	C	1: 182,892,100	S427P	probably benign	Het
Tarbp1	T	A	8: 126,429,040	T1320S	probably benign	Het
Tbpl2	C	T	2: 24,094,638	V166I	probably benign	Het
Thbs1	T	C	2: 118,120,037		probably null	Het
Tnfsf13b	A	G	8: 10,031,648	Y270C	probably damaging	Het
Vps11	G	T	9: 44,348,993	C857*	probably null	Het
Vsig10	G	A	5: 117,325,039	R110H	probably benign	Het
Wee2	T	A	6: 40,455,110	Y204*	probably null	Het
Zfpm2	T	A	15: 41,103,471	S1117R	probably damaging	Het
Zscan5b	A	G	7: 6,231,473	N166S	probably benign	Het

Other mutations in Dip2c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Dip2c	APN	13	9493108	missense	probably damaging	0.97
IGL00426:Dip2c	APN	13	9606515	missense	probably damaging	1.00
IGL00503:Dip2c	APN	13	9567898	missense	probably damaging	1.00
IGL00586:Dip2c	APN	13	9610755	missense	probably damaging	1.00
IGL01306:Dip2c	APN	13	9575143	missense	possibly damaging	0.72
IGL01580:Dip2c	APN	13	9637088	splice site	probably null
IGL01985:Dip2c	APN	13	9553267	splice site	probably benign
IGL02060:Dip2c	APN	13	9622630	missense	probably damaging	0.98
IGL02122:Dip2c	APN	13	9506659	missense	possibly damaging	0.48
IGL02170:Dip2c	APN	13	9606335	missense	probably benign	0.03
IGL02211:Dip2c	APN	13	9610847	missense	probably damaging	1.00
IGL02755:Dip2c	APN	13	9550320	critical splice donor site	probably null
IGL02836:Dip2c	APN	13	9610790	missense	probably damaging	0.98
IGL02935:Dip2c	APN	13	9662146	missense	probably damaging	1.00
IGL03032:Dip2c	APN	13	9551778	missense	probably damaging	1.00
ANU23:Dip2c	UTSW	13	9575143	missense	possibly damaging	0.72
P0038:Dip2c	UTSW	13	9646982	missense	probably damaging	1.00
R0009:Dip2c	UTSW	13	9621903	missense	probably damaging	1.00
R0268:Dip2c	UTSW	13	9637150	missense	probably damaging	1.00
R0271:Dip2c	UTSW	13	9615775	missense	probably damaging	1.00
R0306:Dip2c	UTSW	13	9604599	missense	probably benign	0.09
R0415:Dip2c	UTSW	13	9568289	splice site	probably benign
R0519:Dip2c	UTSW	13	9563208	missense	probably damaging	1.00
R0557:Dip2c	UTSW	13	9553459	missense	possibly damaging	0.81
R0964:Dip2c	UTSW	13	9568663	missense	probably benign	0.43
R0973:Dip2c	UTSW	13	9576908	missense	probably damaging	0.99
R0973:Dip2c	UTSW	13	9576908	missense	probably damaging	0.99
R0974:Dip2c	UTSW	13	9576908	missense	probably damaging	0.99
R1101:Dip2c	UTSW	13	9634744	missense	probably damaging	1.00
R1171:Dip2c	UTSW	13	9493126	missense	possibly damaging	0.89
R1403:Dip2c	UTSW	13	9553264	splice site	probably null
R1403:Dip2c	UTSW	13	9553264	splice site	probably null
R1432:Dip2c	UTSW	13	9553304	missense	probably damaging	0.99
R1481:Dip2c	UTSW	13	9551866	critical splice donor site	probably null
R1588:Dip2c	UTSW	13	9665864	missense	probably damaging	1.00
R1721:Dip2c	UTSW	13	9659368	missense	probably damaging	1.00
R1726:Dip2c	UTSW	13	9575428	missense	probably damaging	1.00
R1867:Dip2c	UTSW	13	9621949	missense	possibly damaging	0.55
R1909:Dip2c	UTSW	13	9533350	missense	probably benign	0.00
R2013:Dip2c	UTSW	13	9567846	nonsense	probably null
R2022:Dip2c	UTSW	13	9551800	missense	probably damaging	1.00
R2517:Dip2c	UTSW	13	9609005	missense	probably damaging	1.00
R3746:Dip2c	UTSW	13	9601473	missense	probably damaging	1.00
R3794:Dip2c	UTSW	13	9604561	missense	probably damaging	0.99
R3884:Dip2c	UTSW	13	9551858	missense	probably damaging	1.00
R4019:Dip2c	UTSW	13	9614365	missense	probably damaging	0.99
R4110:Dip2c	UTSW	13	9637101	missense	probably damaging	1.00
R4111:Dip2c	UTSW	13	9637101	missense	probably damaging	1.00
R4113:Dip2c	UTSW	13	9637101	missense	probably damaging	1.00
R4256:Dip2c	UTSW	13	9609056	missense	probably damaging	1.00
R4300:Dip2c	UTSW	13	9610711	missense	probably damaging	1.00
R4494:Dip2c	UTSW	13	9571062	missense	possibly damaging	0.64
R4739:Dip2c	UTSW	13	9533339	missense	probably damaging	0.98
R4812:Dip2c	UTSW	13	9637130	nonsense	probably null
R4814:Dip2c	UTSW	13	9536860	missense	probably benign	0.07
R4816:Dip2c	UTSW	13	9575150	missense	probably benign	0.37
R4828:Dip2c	UTSW	13	9560679	missense	probably damaging	1.00
R4915:Dip2c	UTSW	13	9621869	splice site	probably null
R4917:Dip2c	UTSW	13	9621869	splice site	probably null
R4932:Dip2c	UTSW	13	9623972	missense	probably damaging	0.99
R4993:Dip2c	UTSW	13	9575223	nonsense	probably null
R5043:Dip2c	UTSW	13	9551827	missense	possibly damaging	0.80
R5349:Dip2c	UTSW	13	9622653	missense	probably damaging	1.00
R5744:Dip2c	UTSW	13	9568405	missense	probably damaging	1.00
R5840:Dip2c	UTSW	13	9506676	missense	possibly damaging	0.68
R6110:Dip2c	UTSW	13	9623766	missense	probably damaging	1.00
R6160:Dip2c	UTSW	13	9533254	missense	probably benign	0.01
R6161:Dip2c	UTSW	13	9647007	missense	probably damaging	1.00
R6477:Dip2c	UTSW	13	9623760	missense	probably damaging	1.00
R6522:Dip2c	UTSW	13	9575228	critical splice donor site	probably null
R6603:Dip2c	UTSW	13	9654588	splice site	probably null
R6658:Dip2c	UTSW	13	9493177	critical splice donor site	probably null
R6672:Dip2c	UTSW	13	9567830	critical splice acceptor site	probably null
R6697:Dip2c	UTSW	13	9621913	missense	probably damaging	1.00
R6991:Dip2c	UTSW	13	9551860	nonsense	probably null
R6991:Dip2c	UTSW	13	9634832	missense	probably damaging	1.00
R7018:Dip2c	UTSW	13	9659278	missense	probably damaging	1.00
R7053:Dip2c	UTSW	13	9610704	missense	probably damaging	1.00
R7102:Dip2c	UTSW	13	9604536	missense	probably benign	0.01
R7171:Dip2c	UTSW	13	9506648	missense	probably benign	0.34
R7371:Dip2c	UTSW	13	9592749	missense	probably benign	0.02
R7395:Dip2c	UTSW	13	9614377	missense	probably damaging	1.00
R7489:Dip2c	UTSW	13	9533312	missense	probably damaging	0.99
R7575:Dip2c	UTSW	13	9628012	missense	probably damaging	0.97
R7642:Dip2c	UTSW	13	9622705	critical splice donor site	probably null
R7687:Dip2c	UTSW	13	9604581	missense	probably benign	0.00
R7699:Dip2c	UTSW	13	9659311	missense	probably benign	0.00
R7700:Dip2c	UTSW	13	9659311	missense	probably benign	0.00
R7715:Dip2c	UTSW	13	9614391	missense	probably damaging	1.00
R7842:Dip2c	UTSW	13	9606533	critical splice donor site	probably null
R7845:Dip2c	UTSW	13	9609044	missense	probably damaging	1.00
R8354:Dip2c	UTSW	13	9621882	missense	probably benign	0.05
R8685:Dip2c	UTSW	13	9637125	missense	probably benign	0.01
R8779:Dip2c	UTSW	13	9610809	missense	probably damaging	0.98
R8786:Dip2c	UTSW	13	9615794	missense	probably damaging	0.99
R8815:Dip2c	UTSW	13	9623798	nonsense	probably null
R8833:Dip2c	UTSW	13	9575483	critical splice donor site	probably null
R8868:Dip2c	UTSW	13	9575467	missense	possibly damaging	0.73
R8873:Dip2c	UTSW	13	9575146	missense	probably benign	0.03
R8887:Dip2c	UTSW	13	9623953	splice site	probably benign
R8923:Dip2c	UTSW	13	9623865	missense	probably damaging	1.00
R9112:Dip2c	UTSW	13	9610730	missense	probably damaging	1.00
R9424:Dip2c	UTSW	13	9659395	missense	probably damaging	1.00
R9527:Dip2c	UTSW	13	9494839	missense	unknown
R9593:Dip2c	UTSW	13	9654647	missense	possibly damaging	0.89
R9615:Dip2c	UTSW	13	9575155	missense	probably benign	0.03
R9801:Dip2c	UTSW	13	9576900	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCGATTGAAGCCCTTGGTG -3'
(R):5'- AGGCAGGTATTCTCTTTCAGGAC -3'

Sequencing Primer
(F):5'- ATTGAAGCCCTTGGTGGTCTG -3'
(R):5'- GCAGGTATTCTCTTTCAGGACCTAAC -3'

Posted On

2022-06-15