Incidental Mutation 'R9474:Inhba'
ID 715666
Institutional Source Beutler Lab
Gene Symbol Inhba
Ensembl Gene ENSMUSG00000041324
Gene Name inhibin beta-A
Synonyms activin
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9474 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 16011851-16031621 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 16017678 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Alanine at position 128 (E128A)
Ref Sequence ENSEMBL: ENSMUSP00000047894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042603] [ENSMUST00000164993]
AlphaFold Q04998
Predicted Effect probably benign
Transcript: ENSMUST00000042603
AA Change: E128A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000047894
Gene: ENSMUSG00000041324
AA Change: E128A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TGFb_propeptide 37 294 9.5e-20 PFAM
TGFB 319 424 1.3e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164993
AA Change: E128A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000132085
Gene: ENSMUSG00000041324
AA Change: E128A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TGFb_propeptide 45 293 3.8e-12 PFAM
TGFB 319 424 1.3e-58 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the TGF-beta (transforming growth factor-beta) superfamily of proteins. The encoded preproprotein is proteolytically processed to generate a subunit of the dimeric activin and inhibin protein complexes. These complexes activate and inhibit, respectively, follicle stimulating hormone secretion from the pituitary gland. The encoded protein also plays a role in eye, tooth and testis development. Homozygous knockout mice for this gene lack whiskers and exhibit tooth and palate defects, leading to neonatal lethality. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygotes for a targeted null mutation lack vibrissae and lower incisors, have defects in their secondary palates, and die shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik C A 10: 79,067,731 K250N probably damaging Het
9530077C05Rik T C 9: 22,431,719 M303T probably damaging Het
Adam5 A T 8: 24,747,524 D623E possibly damaging Het
Akt3 T C 1: 177,025,386 Y473C probably damaging Het
Ankib1 A G 5: 3,755,617 Y217H probably damaging Het
Clca4b T A 3: 144,911,166 T908S probably benign Het
Clec7a G A 6: 129,463,163 Q160* probably null Het
Cntnap4 T A 8: 112,733,471 I152N probably damaging Het
Ctdspl C T 9: 119,037,377 A179V probably damaging Het
Ddx43 T C 9: 78,406,386 S200P probably damaging Het
Dip2c A G 13: 9,494,927 D84G unknown Het
Dmbt1 G A 7: 131,074,257 R625H unknown Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
E2f7 C T 10: 110,767,189 T355I probably damaging Het
E2f7 C A 10: 110,779,057 L541M probably damaging Het
Elovl5 T A 9: 77,982,725 S273T possibly damaging Het
Emc1 T A 4: 139,366,394 L605Q probably damaging Het
Fras1 T A 5: 96,739,265 D2635E probably benign Het
Gabrb1 G A 5: 72,108,347 G195E probably damaging Het
Galm A G 17: 80,150,132 D199G possibly damaging Het
Galntl6 T G 8: 57,777,325 S20R probably damaging Het
Gm21671 A T 5: 25,953,138 I72N probably damaging Het
Grb14 T G 2: 64,938,400 Y189S probably damaging Het
Hk2 T A 6: 82,728,914 I803F probably damaging Het
Hmcn1 G A 1: 150,630,720 R3779W probably damaging Het
Hmgcr A C 13: 96,659,895 M260R probably damaging Het
Hsbp1l1 T A 18: 80,233,424 K68N possibly damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Klhl3 G A 13: 58,019,459 P364S probably damaging Het
Lhpp T C 7: 132,641,583 L176P probably damaging Het
Lrp1b C A 2: 40,601,587 A223S probably damaging Het
Lrp3 A G 7: 35,204,064 F286L probably damaging Het
Lrrc7 T C 3: 158,135,391 T1337A probably benign Het
Magi2 A G 5: 20,195,021 D17G probably benign Het
Map3k21 T C 8: 125,924,164 S302P probably damaging Het
Mbtd1 A G 11: 93,925,685 D386G probably benign Het
Mfsd2b A T 12: 4,866,820 D306E possibly damaging Het
Muc20 T C 16: 32,794,083 E308G probably damaging Het
Myh13 G A 11: 67,364,886 S34N Het
Nebl C A 2: 17,369,610 G894* probably null Het
Nelfa A G 5: 33,898,751 Y523H probably damaging Het
Ninj1 A G 13: 49,187,600 D13G probably benign Het
Ninl A T 2: 150,940,806 S170T probably benign Het
Nlrp4c G A 7: 6,065,627 V176M possibly damaging Het
Nobox G A 6: 43,307,181 R144C probably damaging Het
Oas1a G A 5: 120,899,254 L237F probably damaging Het
Olfr1099 A G 2: 86,959,413 M15T probably benign Het
Olfr1153 T C 2: 87,896,349 M50T probably benign Het
Olfr1254 A C 2: 89,789,162 Y63* probably null Het
Olfr1348 A G 7: 6,502,151 L25P probably benign Het
Olfr1356 T C 10: 78,847,057 N286S probably damaging Het
Olfr625-ps1 A T 7: 103,683,270 Y184F probably damaging Het
Orai1 A G 5: 123,029,238 N158S probably damaging Het
Pa2g4 C A 10: 128,563,098 V121L probably benign Het
Pclo T C 5: 14,521,236 S212P possibly damaging Het
Plce1 G A 19: 38,777,893 E2121K possibly damaging Het
Plg A G 17: 12,403,137 Y448C probably damaging Het
Plppr4 A T 3: 117,323,217 N330K probably damaging Het
Pou2f2 A G 7: 25,094,822 L373S probably benign Het
Rnpep A G 1: 135,283,603 F136L probably benign Het
Rp1 A G 1: 4,092,615 probably null Het
Shank1 G A 7: 44,312,918 S71N unknown Het
Slc5a4a GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC 10: 76,150,404 probably benign Het
Slc5a5 T C 8: 70,884,952 D574G probably benign Het
Slc7a15 T A 12: 8,538,794 N251I probably damaging Het
Susd4 T C 1: 182,892,100 S427P probably benign Het
Tarbp1 T A 8: 126,429,040 T1320S probably benign Het
Tbpl2 C T 2: 24,094,638 V166I probably benign Het
Thbs1 T C 2: 118,120,037 probably null Het
Tnfsf13b A G 8: 10,031,648 Y270C probably damaging Het
Vps11 G T 9: 44,348,993 C857* probably null Het
Vsig10 G A 5: 117,325,039 R110H probably benign Het
Wee2 T A 6: 40,455,110 Y204* probably null Het
Zfpm2 T A 15: 41,103,471 S1117R probably damaging Het
Zscan5b A G 7: 6,231,473 N166S probably benign Het
Other mutations in Inhba
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02116:Inhba APN 13 16026972 missense probably benign 0.00
IGL02666:Inhba APN 13 16027079 missense possibly damaging 0.87
IGL03138:Inhba UTSW 13 16017514 missense probably benign
R0020:Inhba UTSW 13 16026364 missense possibly damaging 0.46
R0591:Inhba UTSW 13 16026820 missense probably damaging 1.00
R1510:Inhba UTSW 13 16027022 missense probably damaging 0.99
R1667:Inhba UTSW 13 16026624 missense possibly damaging 0.90
R1966:Inhba UTSW 13 16026636 missense probably damaging 1.00
R4710:Inhba UTSW 13 16026483 missense probably benign
R4893:Inhba UTSW 13 16026549 missense possibly damaging 0.61
R5472:Inhba UTSW 13 16026786 missense probably damaging 0.99
R5905:Inhba UTSW 13 16017308 missense probably benign 0.05
R7555:Inhba UTSW 13 16017637 missense probably benign 0.28
R7965:Inhba UTSW 13 16026987 missense possibly damaging 0.75
R8031:Inhba UTSW 13 16026275 missense possibly damaging 0.86
R8997:Inhba UTSW 13 16026522 missense possibly damaging 0.94
R9004:Inhba UTSW 13 16026941 missense probably benign 0.05
R9359:Inhba UTSW 13 16017381 missense probably benign 0.01
R9403:Inhba UTSW 13 16017381 missense probably benign 0.01
R9505:Inhba UTSW 13 16026771 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCACTTGAAGAAGAGACCCG -3'
(R):5'- TGTAAGCTAGCCATTGCGGG -3'

Sequencing Primer
(F):5'- CACTTGAAGAAGAGACCCGATGTC -3'
(R):5'- TGGCAAAGAAGTCCTTTCCC -3'
Posted On 2022-06-15