Incidental Mutation 'R9474:Hmgcr'
ID 715669
Institutional Source Beutler Lab
Gene Symbol Hmgcr
Ensembl Gene ENSMUSG00000021670
Gene Name 3-hydroxy-3-methylglutaryl-Coenzyme A reductase
Synonyms Red, 3-hydroxy-3-methylglutaryl-CoA reductase, HMG-CoAR
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9474 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 96785475-96807444 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 96796403 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Arginine at position 260 (M260R)
Ref Sequence ENSEMBL: ENSMUSP00000022176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022176] [ENSMUST00000168855] [ENSMUST00000169196] [ENSMUST00000169202] [ENSMUST00000170287]
AlphaFold Q01237
Predicted Effect probably damaging
Transcript: ENSMUST00000022176
AA Change: M260R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022176
Gene: ENSMUSG00000021670
AA Change: M260R

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
Pfam:Patched 56 342 2.7e-11 PFAM
Pfam:Sterol-sensing 85 234 3.4e-20 PFAM
Pfam:HMG-CoA_red 490 870 2.2e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168855
Predicted Effect probably benign
Transcript: ENSMUST00000169196
SMART Domains Protein: ENSMUSP00000132749
Gene: ENSMUSG00000021670

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
Pfam:Sterol-sensing 85 210 4.7e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169202
SMART Domains Protein: ENSMUSP00000132155
Gene: ENSMUSG00000021670

DomainStartEndE-ValueType
Pfam:HMG-CoA_red 35 219 8.8e-76 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170287
AA Change: M260R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128939
Gene: ENSMUSG00000021670
AA Change: M260R

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
Pfam:Patched 56 347 1.4e-11 PFAM
Pfam:Sterol-sensing 85 234 7.4e-20 PFAM
Pfam:HMG-CoA_red 488 819 1.3e-148 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HMG-CoA reductase is the rate-limiting enzyme for cholesterol synthesis and is regulated via a negative feedback mechanism mediated by sterols and non-sterol metabolites derived from mevalonate, the product of the reaction catalyzed by reductase. Normally in mammalian cells this enzyme is suppressed by cholesterol derived from the internalization and degradation of low density lipoprotein (LDL) via the LDL receptor. Competitive inhibitors of the reductase induce the expression of LDL receptors in the liver, which in turn increases the catabolism of plasma LDL and lowers the plasma concentration of cholesterol, an important determinant of atherosclerosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Inactivation of both copies of this gene results in early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik C A 10: 78,903,565 (GRCm39) K250N probably damaging Het
Adam5 A T 8: 25,237,540 (GRCm39) D623E possibly damaging Het
Akt3 T C 1: 176,852,952 (GRCm39) Y473C probably damaging Het
Ankib1 A G 5: 3,805,617 (GRCm39) Y217H probably damaging Het
Clca4b T A 3: 144,616,927 (GRCm39) T908S probably benign Het
Clec7a G A 6: 129,440,126 (GRCm39) Q160* probably null Het
Cntnap4 T A 8: 113,460,103 (GRCm39) I152N probably damaging Het
Ctdspl C T 9: 118,866,445 (GRCm39) A179V probably damaging Het
Ddx43 T C 9: 78,313,668 (GRCm39) S200P probably damaging Het
Dip2c A G 13: 9,544,963 (GRCm39) D84G unknown Het
Dmbt1 G A 7: 130,675,987 (GRCm39) R625H unknown Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 72,684,217 (GRCm39) probably benign Het
E2f7 C T 10: 110,603,050 (GRCm39) T355I probably damaging Het
E2f7 C A 10: 110,614,918 (GRCm39) L541M probably damaging Het
Elovl5 T A 9: 77,890,007 (GRCm39) S273T possibly damaging Het
Emc1 T A 4: 139,093,705 (GRCm39) L605Q probably damaging Het
Fras1 T A 5: 96,887,124 (GRCm39) D2635E probably benign Het
Gabrb1 G A 5: 72,265,690 (GRCm39) G195E probably damaging Het
Galm A G 17: 80,457,561 (GRCm39) D199G possibly damaging Het
Galntl6 T G 8: 58,230,359 (GRCm39) S20R probably damaging Het
Grb14 T G 2: 64,768,744 (GRCm39) Y189S probably damaging Het
Hk2 T A 6: 82,705,895 (GRCm39) I803F probably damaging Het
Hmcn1 G A 1: 150,506,471 (GRCm39) R3779W probably damaging Het
Hsbp1l1 T A 18: 80,276,639 (GRCm39) K68N possibly damaging Het
Inhba A C 13: 16,192,263 (GRCm39) E128A probably benign Het
Itpr3 G A 17: 27,337,651 (GRCm39) probably benign Het
Klhl3 G A 13: 58,167,273 (GRCm39) P364S probably damaging Het
Lhpp T C 7: 132,243,312 (GRCm39) L176P probably damaging Het
Lrp1b C A 2: 40,491,599 (GRCm39) A223S probably damaging Het
Lrp3 A G 7: 34,903,489 (GRCm39) F286L probably damaging Het
Lrrc7 T C 3: 157,841,028 (GRCm39) T1337A probably benign Het
Magi2 A G 5: 20,400,019 (GRCm39) D17G probably benign Het
Map3k21 T C 8: 126,650,903 (GRCm39) S302P probably damaging Het
Matcap2 T C 9: 22,343,015 (GRCm39) M303T probably damaging Het
Mbtd1 A G 11: 93,816,511 (GRCm39) D386G probably benign Het
Mfsd2b A T 12: 4,916,820 (GRCm39) D306E possibly damaging Het
Muc20 T C 16: 32,614,453 (GRCm39) E308G probably damaging Het
Myh13 G A 11: 67,255,712 (GRCm39) S34N Het
Nebl C A 2: 17,374,421 (GRCm39) G894* probably null Het
Nelfa A G 5: 34,056,095 (GRCm39) Y523H probably damaging Het
Ninj1 A G 13: 49,341,076 (GRCm39) D13G probably benign Het
Ninl A T 2: 150,782,726 (GRCm39) S170T probably benign Het
Nlrp4c G A 7: 6,068,626 (GRCm39) V176M possibly damaging Het
Nobox G A 6: 43,284,115 (GRCm39) R144C probably damaging Het
Oas1a G A 5: 121,037,317 (GRCm39) L237F probably damaging Het
Or4a81 A C 2: 89,619,506 (GRCm39) Y63* probably null Het
Or52z15 A T 7: 103,332,477 (GRCm39) Y184F probably damaging Het
Or5w20 T C 2: 87,726,693 (GRCm39) M50T probably benign Het
Or6z1 A G 7: 6,505,150 (GRCm39) L25P probably benign Het
Or7c70 T C 10: 78,682,891 (GRCm39) N286S probably damaging Het
Or8h9 A G 2: 86,789,757 (GRCm39) M15T probably benign Het
Orai1 A G 5: 123,167,301 (GRCm39) N158S probably damaging Het
Pa2g4 C A 10: 128,398,967 (GRCm39) V121L probably benign Het
Pclo T C 5: 14,571,250 (GRCm39) S212P possibly damaging Het
Plce1 G A 19: 38,766,337 (GRCm39) E2121K possibly damaging Het
Plg A G 17: 12,622,024 (GRCm39) Y448C probably damaging Het
Plppr4 A T 3: 117,116,866 (GRCm39) N330K probably damaging Het
Pou2f2 A G 7: 24,794,247 (GRCm39) L373S probably benign Het
Rnpep A G 1: 135,211,341 (GRCm39) F136L probably benign Het
Rp1 A G 1: 4,162,838 (GRCm39) probably null Het
Shank1 G A 7: 43,962,342 (GRCm39) S71N unknown Het
Slc5a4a GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC 10: 75,986,238 (GRCm39) probably benign Het
Slc5a5 T C 8: 71,337,596 (GRCm39) D574G probably benign Het
Slc7a15 T A 12: 8,588,794 (GRCm39) N251I probably damaging Het
Speer4a3 A T 5: 26,158,136 (GRCm39) I72N probably damaging Het
Susd4 T C 1: 182,719,665 (GRCm39) S427P probably benign Het
Tarbp1 T A 8: 127,155,779 (GRCm39) T1320S probably benign Het
Tbpl2 C T 2: 23,984,650 (GRCm39) V166I probably benign Het
Thbs1 T C 2: 117,950,518 (GRCm39) probably null Het
Tnfsf13b A G 8: 10,081,648 (GRCm39) Y270C probably damaging Het
Vps11 G T 9: 44,260,290 (GRCm39) C857* probably null Het
Vsig10 G A 5: 117,463,104 (GRCm39) R110H probably benign Het
Wee2 T A 6: 40,432,044 (GRCm39) Y204* probably null Het
Zfpm2 T A 15: 40,966,867 (GRCm39) S1117R probably damaging Het
Zscan5b A G 7: 6,234,472 (GRCm39) N166S probably benign Het
Other mutations in Hmgcr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Hmgcr APN 13 96,795,786 (GRCm39) missense probably benign
IGL01369:Hmgcr APN 13 96,803,030 (GRCm39) missense probably null 1.00
IGL01575:Hmgcr APN 13 96,793,103 (GRCm39) missense possibly damaging 0.56
IGL02183:Hmgcr APN 13 96,799,635 (GRCm39) missense probably damaging 1.00
IGL02515:Hmgcr APN 13 96,803,020 (GRCm39) splice site probably benign
IGL02716:Hmgcr APN 13 96,796,520 (GRCm39) critical splice acceptor site probably null
IGL03278:Hmgcr APN 13 96,793,270 (GRCm39) splice site probably benign
IGL03367:Hmgcr APN 13 96,802,361 (GRCm39) missense probably damaging 0.98
PIT4131001:Hmgcr UTSW 13 96,795,562 (GRCm39) missense probably damaging 1.00
PIT4504001:Hmgcr UTSW 13 96,799,605 (GRCm39) missense possibly damaging 0.95
R0003:Hmgcr UTSW 13 96,788,653 (GRCm39) missense probably damaging 1.00
R0017:Hmgcr UTSW 13 96,788,597 (GRCm39) splice site probably benign
R0017:Hmgcr UTSW 13 96,788,597 (GRCm39) splice site probably benign
R0217:Hmgcr UTSW 13 96,788,488 (GRCm39) missense probably damaging 1.00
R0511:Hmgcr UTSW 13 96,796,651 (GRCm39) splice site probably null
R0707:Hmgcr UTSW 13 96,787,151 (GRCm39) unclassified probably benign
R1301:Hmgcr UTSW 13 96,795,528 (GRCm39) missense probably damaging 0.97
R2203:Hmgcr UTSW 13 96,793,141 (GRCm39) missense probably damaging 1.00
R2204:Hmgcr UTSW 13 96,793,141 (GRCm39) missense probably damaging 1.00
R2433:Hmgcr UTSW 13 96,802,393 (GRCm39) missense probably damaging 1.00
R2938:Hmgcr UTSW 13 96,799,576 (GRCm39) missense probably damaging 0.99
R3159:Hmgcr UTSW 13 96,802,355 (GRCm39) missense probably damaging 1.00
R3737:Hmgcr UTSW 13 96,787,571 (GRCm39) missense probably damaging 1.00
R3752:Hmgcr UTSW 13 96,799,624 (GRCm39) missense probably damaging 1.00
R3837:Hmgcr UTSW 13 96,795,597 (GRCm39) missense probably benign 0.19
R3838:Hmgcr UTSW 13 96,795,597 (GRCm39) missense probably benign 0.19
R3839:Hmgcr UTSW 13 96,795,597 (GRCm39) missense probably benign 0.19
R4034:Hmgcr UTSW 13 96,787,571 (GRCm39) missense probably damaging 1.00
R4035:Hmgcr UTSW 13 96,787,571 (GRCm39) missense probably damaging 1.00
R4210:Hmgcr UTSW 13 96,796,729 (GRCm39) missense probably damaging 1.00
R4783:Hmgcr UTSW 13 96,802,701 (GRCm39) missense probably damaging 1.00
R4820:Hmgcr UTSW 13 96,796,700 (GRCm39) missense probably damaging 1.00
R5090:Hmgcr UTSW 13 96,787,098 (GRCm39) missense probably benign
R5113:Hmgcr UTSW 13 96,793,240 (GRCm39) missense probably benign 0.00
R5209:Hmgcr UTSW 13 96,803,020 (GRCm39) splice site probably benign
R5354:Hmgcr UTSW 13 96,791,404 (GRCm39) missense probably benign 0.26
R5571:Hmgcr UTSW 13 96,803,171 (GRCm39) missense probably benign 0.11
R5804:Hmgcr UTSW 13 96,802,695 (GRCm39) missense probably damaging 0.98
R5886:Hmgcr UTSW 13 96,796,691 (GRCm39) missense probably damaging 1.00
R6340:Hmgcr UTSW 13 96,802,366 (GRCm39) missense probably damaging 1.00
R6638:Hmgcr UTSW 13 96,795,490 (GRCm39) missense probably benign
R6699:Hmgcr UTSW 13 96,796,717 (GRCm39) missense probably damaging 1.00
R7024:Hmgcr UTSW 13 96,795,418 (GRCm39) missense probably benign 0.10
R7061:Hmgcr UTSW 13 96,802,656 (GRCm39) missense possibly damaging 0.64
R7284:Hmgcr UTSW 13 96,789,173 (GRCm39) missense probably damaging 1.00
R7286:Hmgcr UTSW 13 96,803,105 (GRCm39) missense probably damaging 1.00
R7705:Hmgcr UTSW 13 96,793,231 (GRCm39) missense probably benign 0.01
R7709:Hmgcr UTSW 13 96,799,605 (GRCm39) missense possibly damaging 0.95
R9034:Hmgcr UTSW 13 96,795,885 (GRCm39) missense probably damaging 1.00
R9158:Hmgcr UTSW 13 96,792,170 (GRCm39) nonsense probably null
R9253:Hmgcr UTSW 13 96,796,645 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCTGTTCAGGAGAGCAAG -3'
(R):5'- AGTAGTACTTCCCATGCTGCC -3'

Sequencing Primer
(F):5'- TTGTATCCCAGCACTCAGGG -3'
(R):5'- ATGCTGCCCCTCTCCTTAG -3'
Posted On 2022-06-15