Mutagenetix > Incidental Mutation

Incidental Mutation 'R9474:Zfpm2'

715670

Institutional Source

Beutler Lab

Gene Symbol

Zfpm2

Ensembl Gene

ENSMUSG00000022306

Gene Name

zinc finger protein, multitype 2

Synonyms

B330005D23Rik, FOG2, FOG-2

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R9474 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

40655035-41104592 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 41103471 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 1117 (S1117R)

Ref Sequence

ENSEMBL: ENSMUSP00000051335 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053467] [ENSMUST00000230319]

AlphaFold

Q8CCH7

Predicted Effect

probably damaging
Transcript: ENSMUST00000053467
AA Change: S1117R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000051335
Gene: ENSMUSG00000022306
AA Change: S1117R

Domain	Start	End	E-Value	Type
low complexity region	19	35	N/A	INTRINSIC
ZnF_C2H2	250	270	4.27e1	SMART
ZnF_C2H2	296	320	1.25e-1	SMART
ZnF_C2H2	335	357	4.05e-1	SMART
ZnF_C2H2	363	385	6.23e-2	SMART
ZnF_C2H2	548	569	1.43e1	SMART
ZnF_C2H2	687	714	1.06e2	SMART
low complexity region	731	741	N/A	INTRINSIC
ZnF_C2H2	854	874	5.4e1	SMART
ZnF_C2H2	1119	1145	4.99e1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000230319
AA Change: S985R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zinc finger protein encoded by this gene is a widely expressed member of the FOG family of transcription factors. The family members modulate the activity of GATA family proteins, which are important regulators of hematopoiesis and cardiogenesis in mammals. It has been demonstrated that the protein can both activate and down-regulate expression of GATA-target genes, suggesting different modulation in different promoter contexts. A related mRNA suggests an alternatively spliced product but this information is not yet fully supported by the sequence. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit cardiac defects, including absence of coronary vasculature, resulting in lethality between E12.5 and E15.5. Conditional mutations reveal errors in ovary and testis development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610008E11Rik	C	A	10: 79,067,731	K250N	probably damaging	Het
9530077C05Rik	T	C	9: 22,431,719	M303T	probably damaging	Het
Adam5	A	T	8: 24,747,524	D623E	possibly damaging	Het
Akt3	T	C	1: 177,025,386	Y473C	probably damaging	Het
Ankib1	A	G	5: 3,755,617	Y217H	probably damaging	Het
Clca4b	T	A	3: 144,911,166	T908S	probably benign	Het
Clec7a	G	A	6: 129,463,163	Q160*	probably null	Het
Cntnap4	T	A	8: 112,733,471	I152N	probably damaging	Het
Ctdspl	C	T	9: 119,037,377	A179V	probably damaging	Het
Ddx43	T	C	9: 78,406,386	S200P	probably damaging	Het
Dip2c	A	G	13: 9,494,927	D84G	unknown	Het
Dmbt1	G	A	7: 131,074,257	R625H	unknown	Het
Dusp9	TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG	TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG	X: 73,640,611		probably benign	Het
E2f7	C	T	10: 110,767,189	T355I	probably damaging	Het
E2f7	C	A	10: 110,779,057	L541M	probably damaging	Het
Elovl5	T	A	9: 77,982,725	S273T	possibly damaging	Het
Emc1	T	A	4: 139,366,394	L605Q	probably damaging	Het
Fras1	T	A	5: 96,739,265	D2635E	probably benign	Het
Gabrb1	G	A	5: 72,108,347	G195E	probably damaging	Het
Galm	A	G	17: 80,150,132	D199G	possibly damaging	Het
Galntl6	T	G	8: 57,777,325	S20R	probably damaging	Het
Gm21671	A	T	5: 25,953,138	I72N	probably damaging	Het
Grb14	T	G	2: 64,938,400	Y189S	probably damaging	Het
Hk2	T	A	6: 82,728,914	I803F	probably damaging	Het
Hmcn1	G	A	1: 150,630,720	R3779W	probably damaging	Het
Hmgcr	A	C	13: 96,659,895	M260R	probably damaging	Het
Hsbp1l1	T	A	18: 80,233,424	K68N	possibly damaging	Het
Inhba	A	C	13: 16,017,678	E128A	probably benign	Het
Itpr3	G	A	17: 27,118,677		probably benign	Het
Klhl3	G	A	13: 58,019,459	P364S	probably damaging	Het
Lhpp	T	C	7: 132,641,583	L176P	probably damaging	Het
Lrp1b	C	A	2: 40,601,587	A223S	probably damaging	Het
Lrp3	A	G	7: 35,204,064	F286L	probably damaging	Het
Lrrc7	T	C	3: 158,135,391	T1337A	probably benign	Het
Magi2	A	G	5: 20,195,021	D17G	probably benign	Het
Map3k21	T	C	8: 125,924,164	S302P	probably damaging	Het
Mbtd1	A	G	11: 93,925,685	D386G	probably benign	Het
Mfsd2b	A	T	12: 4,866,820	D306E	possibly damaging	Het
Muc20	T	C	16: 32,794,083	E308G	probably damaging	Het
Myh13	G	A	11: 67,364,886	S34N		Het
Nebl	C	A	2: 17,369,610	G894*	probably null	Het
Nelfa	A	G	5: 33,898,751	Y523H	probably damaging	Het
Ninj1	A	G	13: 49,187,600	D13G	probably benign	Het
Ninl	A	T	2: 150,940,806	S170T	probably benign	Het
Nlrp4c	G	A	7: 6,065,627	V176M	possibly damaging	Het
Nobox	G	A	6: 43,307,181	R144C	probably damaging	Het
Oas1a	G	A	5: 120,899,254	L237F	probably damaging	Het
Olfr1099	A	G	2: 86,959,413	M15T	probably benign	Het
Olfr1153	T	C	2: 87,896,349	M50T	probably benign	Het
Olfr1254	A	C	2: 89,789,162	Y63*	probably null	Het
Olfr1348	A	G	7: 6,502,151	L25P	probably benign	Het
Olfr1356	T	C	10: 78,847,057	N286S	probably damaging	Het
Olfr625-ps1	A	T	7: 103,683,270	Y184F	probably damaging	Het
Orai1	A	G	5: 123,029,238	N158S	probably damaging	Het
Pa2g4	C	A	10: 128,563,098	V121L	probably benign	Het
Pclo	T	C	5: 14,521,236	S212P	possibly damaging	Het
Plce1	G	A	19: 38,777,893	E2121K	possibly damaging	Het
Plg	A	G	17: 12,403,137	Y448C	probably damaging	Het
Plppr4	A	T	3: 117,323,217	N330K	probably damaging	Het
Pou2f2	A	G	7: 25,094,822	L373S	probably benign	Het
Rnpep	A	G	1: 135,283,603	F136L	probably benign	Het
Rp1	A	G	1: 4,092,615		probably null	Het
Shank1	G	A	7: 44,312,918	S71N	unknown	Het
Slc5a4a	GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC	GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC	10: 76,150,404		probably benign	Het
Slc5a5	T	C	8: 70,884,952	D574G	probably benign	Het
Slc7a15	T	A	12: 8,538,794	N251I	probably damaging	Het
Susd4	T	C	1: 182,892,100	S427P	probably benign	Het
Tarbp1	T	A	8: 126,429,040	T1320S	probably benign	Het
Tbpl2	C	T	2: 24,094,638	V166I	probably benign	Het
Thbs1	T	C	2: 118,120,037		probably null	Het
Tnfsf13b	A	G	8: 10,031,648	Y270C	probably damaging	Het
Vps11	G	T	9: 44,348,993	C857*	probably null	Het
Vsig10	G	A	5: 117,325,039	R110H	probably benign	Het
Wee2	T	A	6: 40,455,110	Y204*	probably null	Het
Zscan5b	A	G	7: 6,231,473	N166S	probably benign	Het

Other mutations in Zfpm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00473:Zfpm2	APN	15	41099287	missense	probably damaging	1.00
IGL00815:Zfpm2	APN	15	41099491	missense	probably benign	0.37
IGL00821:Zfpm2	APN	15	41103387	missense	probably damaging	1.00
IGL01622:Zfpm2	APN	15	41101924	missense	probably benign	0.07
IGL01623:Zfpm2	APN	15	41101924	missense	probably benign	0.07
IGL01807:Zfpm2	APN	15	40753056	critical splice donor site	probably null
IGL01872:Zfpm2	APN	15	41102387	missense	probably benign
IGL02087:Zfpm2	APN	15	41103121	missense	probably damaging	0.97
IGL02123:Zfpm2	APN	15	41102195	missense	probably damaging	1.00
IGL02355:Zfpm2	APN	15	41099494	missense	probably damaging	1.00
IGL02362:Zfpm2	APN	15	41099494	missense	probably damaging	1.00
IGL02579:Zfpm2	APN	15	41099472	missense	possibly damaging	0.91
IGL02752:Zfpm2	APN	15	41102019	missense	probably benign	0.23
IGL02792:Zfpm2	APN	15	41103013	missense	probably benign	0.00
IGL02861:Zfpm2	APN	15	41103266	missense	probably damaging	0.98
IGL03180:Zfpm2	APN	15	41101394	missense	probably damaging	1.00
IGL03344:Zfpm2	APN	15	41102774	missense	probably benign
R0305:Zfpm2	UTSW	15	40774035	splice site	probably benign
R0365:Zfpm2	UTSW	15	40774066	missense	possibly damaging	0.88
R1171:Zfpm2	UTSW	15	41101679	missense	probably damaging	1.00
R1456:Zfpm2	UTSW	15	41102481	missense	probably damaging	1.00
R1482:Zfpm2	UTSW	15	41099291	missense	probably damaging	1.00
R1580:Zfpm2	UTSW	15	41103209	missense	possibly damaging	0.84
R2119:Zfpm2	UTSW	15	41103023	missense	probably damaging	1.00
R2189:Zfpm2	UTSW	15	41101183	missense	possibly damaging	0.76
R2867:Zfpm2	UTSW	15	41099389	missense	probably benign	0.06
R2867:Zfpm2	UTSW	15	41099389	missense	probably benign	0.06
R2886:Zfpm2	UTSW	15	41102323	missense	probably benign	0.44
R3024:Zfpm2	UTSW	15	41102959	missense	probably benign	0.00
R4043:Zfpm2	UTSW	15	40870627	missense	possibly damaging	0.94
R4178:Zfpm2	UTSW	15	41103544	missense	probably damaging	1.00
R4465:Zfpm2	UTSW	15	41096161	missense	probably benign	0.00
R5263:Zfpm2	UTSW	15	41099395	missense	probably benign	0.45
R5266:Zfpm2	UTSW	15	41099469	missense	probably benign	0.01
R5352:Zfpm2	UTSW	15	40870542	missense	probably benign	0.01
R5584:Zfpm2	UTSW	15	41102537	missense	probably benign	0.45
R5661:Zfpm2	UTSW	15	41096071	nonsense	probably null
R6437:Zfpm2	UTSW	15	41099397	missense	probably benign
R6660:Zfpm2	UTSW	15	40655585	critical splice donor site	probably null
R6742:Zfpm2	UTSW	15	41101718	missense	probably benign
R6749:Zfpm2	UTSW	15	40954708	missense	possibly damaging	0.90
R7363:Zfpm2	UTSW	15	40753017	missense	probably damaging	1.00
R7401:Zfpm2	UTSW	15	41102990	missense	possibly damaging	0.87
R7657:Zfpm2	UTSW	15	41103275	missense	possibly damaging	0.78
R7690:Zfpm2	UTSW	15	40954766	missense	possibly damaging	0.45
R7698:Zfpm2	UTSW	15	41096091	missense	probably benign	0.03
R7893:Zfpm2	UTSW	15	41102612	missense	probably damaging	1.00
R8081:Zfpm2	UTSW	15	41102248	missense	probably damaging	1.00
R8223:Zfpm2	UTSW	15	40752959	missense	probably benign	0.34
R9028:Zfpm2	UTSW	15	41103362	missense	possibly damaging	0.87
R9065:Zfpm2	UTSW	15	41099316	missense	possibly damaging	0.95
R9234:Zfpm2	UTSW	15	41103074	missense	probably damaging	1.00
R9694:Zfpm2	UTSW	15	41102314	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- AAGATGAAAGACCTACGGCC -3'
(R):5'- TGCCAGATGTAATTCAAACAGCG -3'

Sequencing Primer
(F):5'- TGAAAGACCTACGGCCAACCC -3'
(R):5'- AAACAGCGTCTTTGTTTTCTGGAC -3'

Posted On

2022-06-15