Incidental Mutation 'R9474:Zfpm2'
ID 715670
Institutional Source Beutler Lab
Gene Symbol Zfpm2
Ensembl Gene ENSMUSG00000022306
Gene Name zinc finger protein, multitype 2
Synonyms B330005D23Rik, FOG2, FOG-2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9474 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 40655035-41104592 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 41103471 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 1117 (S1117R)
Ref Sequence ENSEMBL: ENSMUSP00000051335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053467] [ENSMUST00000230319]
AlphaFold Q8CCH7
Predicted Effect probably damaging
Transcript: ENSMUST00000053467
AA Change: S1117R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000051335
Gene: ENSMUSG00000022306
AA Change: S1117R

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
ZnF_C2H2 250 270 4.27e1 SMART
ZnF_C2H2 296 320 1.25e-1 SMART
ZnF_C2H2 335 357 4.05e-1 SMART
ZnF_C2H2 363 385 6.23e-2 SMART
ZnF_C2H2 548 569 1.43e1 SMART
ZnF_C2H2 687 714 1.06e2 SMART
low complexity region 731 741 N/A INTRINSIC
ZnF_C2H2 854 874 5.4e1 SMART
ZnF_C2H2 1119 1145 4.99e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000230319
AA Change: S985R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zinc finger protein encoded by this gene is a widely expressed member of the FOG family of transcription factors. The family members modulate the activity of GATA family proteins, which are important regulators of hematopoiesis and cardiogenesis in mammals. It has been demonstrated that the protein can both activate and down-regulate expression of GATA-target genes, suggesting different modulation in different promoter contexts. A related mRNA suggests an alternatively spliced product but this information is not yet fully supported by the sequence. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit cardiac defects, including absence of coronary vasculature, resulting in lethality between E12.5 and E15.5. Conditional mutations reveal errors in ovary and testis development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik C A 10: 79,067,731 K250N probably damaging Het
9530077C05Rik T C 9: 22,431,719 M303T probably damaging Het
Adam5 A T 8: 24,747,524 D623E possibly damaging Het
Akt3 T C 1: 177,025,386 Y473C probably damaging Het
Ankib1 A G 5: 3,755,617 Y217H probably damaging Het
Clca4b T A 3: 144,911,166 T908S probably benign Het
Clec7a G A 6: 129,463,163 Q160* probably null Het
Cntnap4 T A 8: 112,733,471 I152N probably damaging Het
Ctdspl C T 9: 119,037,377 A179V probably damaging Het
Ddx43 T C 9: 78,406,386 S200P probably damaging Het
Dip2c A G 13: 9,494,927 D84G unknown Het
Dmbt1 G A 7: 131,074,257 R625H unknown Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
E2f7 C T 10: 110,767,189 T355I probably damaging Het
E2f7 C A 10: 110,779,057 L541M probably damaging Het
Elovl5 T A 9: 77,982,725 S273T possibly damaging Het
Emc1 T A 4: 139,366,394 L605Q probably damaging Het
Fras1 T A 5: 96,739,265 D2635E probably benign Het
Gabrb1 G A 5: 72,108,347 G195E probably damaging Het
Galm A G 17: 80,150,132 D199G possibly damaging Het
Galntl6 T G 8: 57,777,325 S20R probably damaging Het
Gm21671 A T 5: 25,953,138 I72N probably damaging Het
Grb14 T G 2: 64,938,400 Y189S probably damaging Het
Hk2 T A 6: 82,728,914 I803F probably damaging Het
Hmcn1 G A 1: 150,630,720 R3779W probably damaging Het
Hmgcr A C 13: 96,659,895 M260R probably damaging Het
Hsbp1l1 T A 18: 80,233,424 K68N possibly damaging Het
Inhba A C 13: 16,017,678 E128A probably benign Het
Itpr3 G A 17: 27,118,677 probably benign Het
Klhl3 G A 13: 58,019,459 P364S probably damaging Het
Lhpp T C 7: 132,641,583 L176P probably damaging Het
Lrp1b C A 2: 40,601,587 A223S probably damaging Het
Lrp3 A G 7: 35,204,064 F286L probably damaging Het
Lrrc7 T C 3: 158,135,391 T1337A probably benign Het
Magi2 A G 5: 20,195,021 D17G probably benign Het
Map3k21 T C 8: 125,924,164 S302P probably damaging Het
Mbtd1 A G 11: 93,925,685 D386G probably benign Het
Mfsd2b A T 12: 4,866,820 D306E possibly damaging Het
Muc20 T C 16: 32,794,083 E308G probably damaging Het
Myh13 G A 11: 67,364,886 S34N Het
Nebl C A 2: 17,369,610 G894* probably null Het
Nelfa A G 5: 33,898,751 Y523H probably damaging Het
Ninj1 A G 13: 49,187,600 D13G probably benign Het
Ninl A T 2: 150,940,806 S170T probably benign Het
Nlrp4c G A 7: 6,065,627 V176M possibly damaging Het
Nobox G A 6: 43,307,181 R144C probably damaging Het
Oas1a G A 5: 120,899,254 L237F probably damaging Het
Olfr1099 A G 2: 86,959,413 M15T probably benign Het
Olfr1153 T C 2: 87,896,349 M50T probably benign Het
Olfr1254 A C 2: 89,789,162 Y63* probably null Het
Olfr1348 A G 7: 6,502,151 L25P probably benign Het
Olfr1356 T C 10: 78,847,057 N286S probably damaging Het
Olfr625-ps1 A T 7: 103,683,270 Y184F probably damaging Het
Orai1 A G 5: 123,029,238 N158S probably damaging Het
Pa2g4 C A 10: 128,563,098 V121L probably benign Het
Pclo T C 5: 14,521,236 S212P possibly damaging Het
Plce1 G A 19: 38,777,893 E2121K possibly damaging Het
Plg A G 17: 12,403,137 Y448C probably damaging Het
Plppr4 A T 3: 117,323,217 N330K probably damaging Het
Pou2f2 A G 7: 25,094,822 L373S probably benign Het
Rnpep A G 1: 135,283,603 F136L probably benign Het
Rp1 A G 1: 4,092,615 probably null Het
Shank1 G A 7: 44,312,918 S71N unknown Het
Slc5a4a GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC 10: 76,150,404 probably benign Het
Slc5a5 T C 8: 70,884,952 D574G probably benign Het
Slc7a15 T A 12: 8,538,794 N251I probably damaging Het
Susd4 T C 1: 182,892,100 S427P probably benign Het
Tarbp1 T A 8: 126,429,040 T1320S probably benign Het
Tbpl2 C T 2: 24,094,638 V166I probably benign Het
Thbs1 T C 2: 118,120,037 probably null Het
Tnfsf13b A G 8: 10,031,648 Y270C probably damaging Het
Vps11 G T 9: 44,348,993 C857* probably null Het
Vsig10 G A 5: 117,325,039 R110H probably benign Het
Wee2 T A 6: 40,455,110 Y204* probably null Het
Zscan5b A G 7: 6,231,473 N166S probably benign Het
Other mutations in Zfpm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Zfpm2 APN 15 41099287 missense probably damaging 1.00
IGL00815:Zfpm2 APN 15 41099491 missense probably benign 0.37
IGL00821:Zfpm2 APN 15 41103387 missense probably damaging 1.00
IGL01622:Zfpm2 APN 15 41101924 missense probably benign 0.07
IGL01623:Zfpm2 APN 15 41101924 missense probably benign 0.07
IGL01807:Zfpm2 APN 15 40753056 critical splice donor site probably null
IGL01872:Zfpm2 APN 15 41102387 missense probably benign
IGL02087:Zfpm2 APN 15 41103121 missense probably damaging 0.97
IGL02123:Zfpm2 APN 15 41102195 missense probably damaging 1.00
IGL02355:Zfpm2 APN 15 41099494 missense probably damaging 1.00
IGL02362:Zfpm2 APN 15 41099494 missense probably damaging 1.00
IGL02579:Zfpm2 APN 15 41099472 missense possibly damaging 0.91
IGL02752:Zfpm2 APN 15 41102019 missense probably benign 0.23
IGL02792:Zfpm2 APN 15 41103013 missense probably benign 0.00
IGL02861:Zfpm2 APN 15 41103266 missense probably damaging 0.98
IGL03180:Zfpm2 APN 15 41101394 missense probably damaging 1.00
IGL03344:Zfpm2 APN 15 41102774 missense probably benign
R0305:Zfpm2 UTSW 15 40774035 splice site probably benign
R0365:Zfpm2 UTSW 15 40774066 missense possibly damaging 0.88
R1171:Zfpm2 UTSW 15 41101679 missense probably damaging 1.00
R1456:Zfpm2 UTSW 15 41102481 missense probably damaging 1.00
R1482:Zfpm2 UTSW 15 41099291 missense probably damaging 1.00
R1580:Zfpm2 UTSW 15 41103209 missense possibly damaging 0.84
R2119:Zfpm2 UTSW 15 41103023 missense probably damaging 1.00
R2189:Zfpm2 UTSW 15 41101183 missense possibly damaging 0.76
R2867:Zfpm2 UTSW 15 41099389 missense probably benign 0.06
R2867:Zfpm2 UTSW 15 41099389 missense probably benign 0.06
R2886:Zfpm2 UTSW 15 41102323 missense probably benign 0.44
R3024:Zfpm2 UTSW 15 41102959 missense probably benign 0.00
R4043:Zfpm2 UTSW 15 40870627 missense possibly damaging 0.94
R4178:Zfpm2 UTSW 15 41103544 missense probably damaging 1.00
R4465:Zfpm2 UTSW 15 41096161 missense probably benign 0.00
R5263:Zfpm2 UTSW 15 41099395 missense probably benign 0.45
R5266:Zfpm2 UTSW 15 41099469 missense probably benign 0.01
R5352:Zfpm2 UTSW 15 40870542 missense probably benign 0.01
R5584:Zfpm2 UTSW 15 41102537 missense probably benign 0.45
R5661:Zfpm2 UTSW 15 41096071 nonsense probably null
R6437:Zfpm2 UTSW 15 41099397 missense probably benign
R6660:Zfpm2 UTSW 15 40655585 critical splice donor site probably null
R6742:Zfpm2 UTSW 15 41101718 missense probably benign
R6749:Zfpm2 UTSW 15 40954708 missense possibly damaging 0.90
R7363:Zfpm2 UTSW 15 40753017 missense probably damaging 1.00
R7401:Zfpm2 UTSW 15 41102990 missense possibly damaging 0.87
R7657:Zfpm2 UTSW 15 41103275 missense possibly damaging 0.78
R7690:Zfpm2 UTSW 15 40954766 missense possibly damaging 0.45
R7698:Zfpm2 UTSW 15 41096091 missense probably benign 0.03
R7893:Zfpm2 UTSW 15 41102612 missense probably damaging 1.00
R8081:Zfpm2 UTSW 15 41102248 missense probably damaging 1.00
R8223:Zfpm2 UTSW 15 40752959 missense probably benign 0.34
R9028:Zfpm2 UTSW 15 41103362 missense possibly damaging 0.87
R9065:Zfpm2 UTSW 15 41099316 missense possibly damaging 0.95
R9234:Zfpm2 UTSW 15 41103074 missense probably damaging 1.00
R9694:Zfpm2 UTSW 15 41102314 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AAGATGAAAGACCTACGGCC -3'
(R):5'- TGCCAGATGTAATTCAAACAGCG -3'

Sequencing Primer
(F):5'- TGAAAGACCTACGGCCAACCC -3'
(R):5'- AAACAGCGTCTTTGTTTTCTGGAC -3'
Posted On 2022-06-15