Incidental Mutation 'R9474:Plg'
ID 715672
Institutional Source Beutler Lab
Gene Symbol Plg
Ensembl Gene ENSMUSG00000059481
Gene Name plasminogen
Synonyms Pg
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.230) question?
Stock # R9474 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 12597496-12638271 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 12622024 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 448 (Y448C)
Ref Sequence ENSEMBL: ENSMUSP00000014578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014578]
AlphaFold P20918
Predicted Effect probably damaging
Transcript: ENSMUST00000014578
AA Change: Y448C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000014578
Gene: ENSMUSG00000059481
AA Change: Y448C

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PAN_AP 20 97 8.67e-14 SMART
KR 101 183 1.31e-41 SMART
KR 184 264 5.4e-43 SMART
KR 273 354 3.45e-50 SMART
KR 375 456 3.9e-49 SMART
KR 479 562 5.53e-40 SMART
Tryp_SPc 581 805 4.11e-94 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a secreted blood zymogen that is activated by proteolysis and converted to plasmin and angiostatin. Plasmin dissolves fibrin in blood clots and is an important protease in many other cellular processes while angiostatin inhibits angiogenesis. Defects in this gene are likely a cause of thrombophilia and ligneous conjunctivitis. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous null mutants exhibit retarded growth, variable rectal prolapse, impaired fertility and lactation in females, early mortality, and widespread fibrin deposition and thrombotic lesions in liver, lung, stomach and other tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik C A 10: 78,903,565 (GRCm39) K250N probably damaging Het
Adam5 A T 8: 25,237,540 (GRCm39) D623E possibly damaging Het
Akt3 T C 1: 176,852,952 (GRCm39) Y473C probably damaging Het
Ankib1 A G 5: 3,805,617 (GRCm39) Y217H probably damaging Het
Clca4b T A 3: 144,616,927 (GRCm39) T908S probably benign Het
Clec7a G A 6: 129,440,126 (GRCm39) Q160* probably null Het
Cntnap4 T A 8: 113,460,103 (GRCm39) I152N probably damaging Het
Ctdspl C T 9: 118,866,445 (GRCm39) A179V probably damaging Het
Ddx43 T C 9: 78,313,668 (GRCm39) S200P probably damaging Het
Dip2c A G 13: 9,544,963 (GRCm39) D84G unknown Het
Dmbt1 G A 7: 130,675,987 (GRCm39) R625H unknown Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 72,684,217 (GRCm39) probably benign Het
E2f7 C T 10: 110,603,050 (GRCm39) T355I probably damaging Het
E2f7 C A 10: 110,614,918 (GRCm39) L541M probably damaging Het
Elovl5 T A 9: 77,890,007 (GRCm39) S273T possibly damaging Het
Emc1 T A 4: 139,093,705 (GRCm39) L605Q probably damaging Het
Fras1 T A 5: 96,887,124 (GRCm39) D2635E probably benign Het
Gabrb1 G A 5: 72,265,690 (GRCm39) G195E probably damaging Het
Galm A G 17: 80,457,561 (GRCm39) D199G possibly damaging Het
Galntl6 T G 8: 58,230,359 (GRCm39) S20R probably damaging Het
Grb14 T G 2: 64,768,744 (GRCm39) Y189S probably damaging Het
Hk2 T A 6: 82,705,895 (GRCm39) I803F probably damaging Het
Hmcn1 G A 1: 150,506,471 (GRCm39) R3779W probably damaging Het
Hmgcr A C 13: 96,796,403 (GRCm39) M260R probably damaging Het
Hsbp1l1 T A 18: 80,276,639 (GRCm39) K68N possibly damaging Het
Inhba A C 13: 16,192,263 (GRCm39) E128A probably benign Het
Itpr3 G A 17: 27,337,651 (GRCm39) probably benign Het
Klhl3 G A 13: 58,167,273 (GRCm39) P364S probably damaging Het
Lhpp T C 7: 132,243,312 (GRCm39) L176P probably damaging Het
Lrp1b C A 2: 40,491,599 (GRCm39) A223S probably damaging Het
Lrp3 A G 7: 34,903,489 (GRCm39) F286L probably damaging Het
Lrrc7 T C 3: 157,841,028 (GRCm39) T1337A probably benign Het
Magi2 A G 5: 20,400,019 (GRCm39) D17G probably benign Het
Map3k21 T C 8: 126,650,903 (GRCm39) S302P probably damaging Het
Matcap2 T C 9: 22,343,015 (GRCm39) M303T probably damaging Het
Mbtd1 A G 11: 93,816,511 (GRCm39) D386G probably benign Het
Mfsd2b A T 12: 4,916,820 (GRCm39) D306E possibly damaging Het
Muc20 T C 16: 32,614,453 (GRCm39) E308G probably damaging Het
Myh13 G A 11: 67,255,712 (GRCm39) S34N Het
Nebl C A 2: 17,374,421 (GRCm39) G894* probably null Het
Nelfa A G 5: 34,056,095 (GRCm39) Y523H probably damaging Het
Ninj1 A G 13: 49,341,076 (GRCm39) D13G probably benign Het
Ninl A T 2: 150,782,726 (GRCm39) S170T probably benign Het
Nlrp4c G A 7: 6,068,626 (GRCm39) V176M possibly damaging Het
Nobox G A 6: 43,284,115 (GRCm39) R144C probably damaging Het
Oas1a G A 5: 121,037,317 (GRCm39) L237F probably damaging Het
Or4a81 A C 2: 89,619,506 (GRCm39) Y63* probably null Het
Or52z15 A T 7: 103,332,477 (GRCm39) Y184F probably damaging Het
Or5w20 T C 2: 87,726,693 (GRCm39) M50T probably benign Het
Or6z1 A G 7: 6,505,150 (GRCm39) L25P probably benign Het
Or7c70 T C 10: 78,682,891 (GRCm39) N286S probably damaging Het
Or8h9 A G 2: 86,789,757 (GRCm39) M15T probably benign Het
Orai1 A G 5: 123,167,301 (GRCm39) N158S probably damaging Het
Pa2g4 C A 10: 128,398,967 (GRCm39) V121L probably benign Het
Pclo T C 5: 14,571,250 (GRCm39) S212P possibly damaging Het
Plce1 G A 19: 38,766,337 (GRCm39) E2121K possibly damaging Het
Plppr4 A T 3: 117,116,866 (GRCm39) N330K probably damaging Het
Pou2f2 A G 7: 24,794,247 (GRCm39) L373S probably benign Het
Rnpep A G 1: 135,211,341 (GRCm39) F136L probably benign Het
Rp1 A G 1: 4,162,838 (GRCm39) probably null Het
Shank1 G A 7: 43,962,342 (GRCm39) S71N unknown Het
Slc5a4a GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC 10: 75,986,238 (GRCm39) probably benign Het
Slc5a5 T C 8: 71,337,596 (GRCm39) D574G probably benign Het
Slc7a15 T A 12: 8,588,794 (GRCm39) N251I probably damaging Het
Speer4a3 A T 5: 26,158,136 (GRCm39) I72N probably damaging Het
Susd4 T C 1: 182,719,665 (GRCm39) S427P probably benign Het
Tarbp1 T A 8: 127,155,779 (GRCm39) T1320S probably benign Het
Tbpl2 C T 2: 23,984,650 (GRCm39) V166I probably benign Het
Thbs1 T C 2: 117,950,518 (GRCm39) probably null Het
Tnfsf13b A G 8: 10,081,648 (GRCm39) Y270C probably damaging Het
Vps11 G T 9: 44,260,290 (GRCm39) C857* probably null Het
Vsig10 G A 5: 117,463,104 (GRCm39) R110H probably benign Het
Wee2 T A 6: 40,432,044 (GRCm39) Y204* probably null Het
Zfpm2 T A 15: 40,966,867 (GRCm39) S1117R probably damaging Het
Zscan5b A G 7: 6,234,472 (GRCm39) N166S probably benign Het
Other mutations in Plg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Plg APN 17 12,630,380 (GRCm39) missense probably damaging 1.00
IGL01128:Plg APN 17 12,615,586 (GRCm39) splice site probably benign
IGL01522:Plg APN 17 12,622,956 (GRCm39) missense probably damaging 1.00
IGL01981:Plg APN 17 12,621,934 (GRCm39) splice site probably benign
IGL03338:Plg APN 17 12,637,959 (GRCm39) missense probably damaging 1.00
elder UTSW 17 12,609,107 (GRCm39) nonsense probably null
oldster UTSW 17 12,614,641 (GRCm39) missense probably damaging 1.00
R0391:Plg UTSW 17 12,637,968 (GRCm39) missense probably damaging 1.00
R0531:Plg UTSW 17 12,630,334 (GRCm39) splice site probably benign
R0646:Plg UTSW 17 12,637,623 (GRCm39) missense probably damaging 1.00
R0759:Plg UTSW 17 12,629,838 (GRCm39) missense probably damaging 1.00
R1013:Plg UTSW 17 12,597,608 (GRCm39) splice site probably benign
R2116:Plg UTSW 17 12,603,364 (GRCm39) missense probably damaging 0.99
R2442:Plg UTSW 17 12,629,847 (GRCm39) missense probably benign 0.15
R2512:Plg UTSW 17 12,622,116 (GRCm39) missense probably benign
R2879:Plg UTSW 17 12,622,987 (GRCm39) missense possibly damaging 0.92
R3107:Plg UTSW 17 12,603,316 (GRCm39) missense probably benign 0.00
R3405:Plg UTSW 17 12,622,096 (GRCm39) missense possibly damaging 0.65
R4409:Plg UTSW 17 12,609,150 (GRCm39) missense probably damaging 1.00
R4861:Plg UTSW 17 12,614,622 (GRCm39) missense probably benign 0.00
R4861:Plg UTSW 17 12,614,622 (GRCm39) missense probably benign 0.00
R4977:Plg UTSW 17 12,621,976 (GRCm39) missense probably damaging 1.00
R4990:Plg UTSW 17 12,630,397 (GRCm39) missense probably benign
R5319:Plg UTSW 17 12,622,114 (GRCm39) missense possibly damaging 0.49
R5443:Plg UTSW 17 12,601,070 (GRCm39) missense probably benign 0.03
R5635:Plg UTSW 17 12,614,641 (GRCm39) missense probably damaging 1.00
R5981:Plg UTSW 17 12,597,605 (GRCm39) critical splice donor site probably null
R6166:Plg UTSW 17 12,617,001 (GRCm39) missense probably damaging 0.99
R6688:Plg UTSW 17 12,610,732 (GRCm39) missense probably damaging 1.00
R6726:Plg UTSW 17 12,597,595 (GRCm39) missense probably damaging 1.00
R6995:Plg UTSW 17 12,637,938 (GRCm39) missense probably benign 0.00
R7028:Plg UTSW 17 12,610,723 (GRCm39) missense probably damaging 1.00
R7168:Plg UTSW 17 12,607,446 (GRCm39) missense probably damaging 1.00
R7356:Plg UTSW 17 12,629,798 (GRCm39) missense probably damaging 1.00
R8902:Plg UTSW 17 12,629,790 (GRCm39) missense probably benign 0.32
R9035:Plg UTSW 17 12,609,107 (GRCm39) nonsense probably null
R9610:Plg UTSW 17 12,609,213 (GRCm39) missense probably benign 0.12
R9611:Plg UTSW 17 12,609,213 (GRCm39) missense probably benign 0.12
Z1176:Plg UTSW 17 12,633,072 (GRCm39) missense probably benign 0.02
Z1177:Plg UTSW 17 12,622,120 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAGAGGACCATTTGTGACAATGC -3'
(R):5'- GCTTCTACATAAGTAGCACTTCCTC -3'

Sequencing Primer
(F):5'- CTTCAGTGAGATGTTTCAAAGGTAC -3'
(R):5'- ACATAAGTAGCACTTCCTCCTCTGTG -3'
Posted On 2022-06-15