Incidental Mutation 'R9474:Dusp9'
ID 715677
Institutional Source Beutler Lab
Gene Symbol Dusp9
Ensembl Gene ENSMUSG00000031383
Gene Name dual specificity phosphatase 9
Synonyms Mpk4, Pyst3
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.191) question?
Stock # R9474 (G1)
Quality Score 157.526
Status Not validated
Chromosome X
Chromosomal Location 72683025-72687120 bp(+) (GRCm39)
Type of Mutation small deletion (16 aa in frame mutation)
DNA Base Change (assembly) TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG to TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG at 72684217 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000019701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019701]
AlphaFold Q7TNL7
Predicted Effect probably benign
Transcript: ENSMUST00000019701
SMART Domains Protein: ENSMUSP00000019701
Gene: ENSMUSG00000031383

DomainStartEndE-ValueType
RHOD 8 204 2.51e-9 SMART
low complexity region 236 249 N/A INTRINSIC
DSPc 271 411 6.09e-67 SMART
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which is associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product shows selectivity for members of the ERK family of MAP kinases and is localized to the cytoplasm and nucleus. Aberrant expression of this gene is associated with type 2 diabetes and cancer progression in several cell types. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Hemizygous null male and heterozygous null female mice display embryonic lethality during organogenesis with abnormal placental labyrinth morphology when the allele is maternally inherited. Tetraploid rescue produces viable heterozygous and hemizygous mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik C A 10: 78,903,565 (GRCm39) K250N probably damaging Het
Adam5 A T 8: 25,237,540 (GRCm39) D623E possibly damaging Het
Akt3 T C 1: 176,852,952 (GRCm39) Y473C probably damaging Het
Ankib1 A G 5: 3,805,617 (GRCm39) Y217H probably damaging Het
Clca4b T A 3: 144,616,927 (GRCm39) T908S probably benign Het
Clec7a G A 6: 129,440,126 (GRCm39) Q160* probably null Het
Cntnap4 T A 8: 113,460,103 (GRCm39) I152N probably damaging Het
Ctdspl C T 9: 118,866,445 (GRCm39) A179V probably damaging Het
Ddx43 T C 9: 78,313,668 (GRCm39) S200P probably damaging Het
Dip2c A G 13: 9,544,963 (GRCm39) D84G unknown Het
Dmbt1 G A 7: 130,675,987 (GRCm39) R625H unknown Het
E2f7 C T 10: 110,603,050 (GRCm39) T355I probably damaging Het
E2f7 C A 10: 110,614,918 (GRCm39) L541M probably damaging Het
Elovl5 T A 9: 77,890,007 (GRCm39) S273T possibly damaging Het
Emc1 T A 4: 139,093,705 (GRCm39) L605Q probably damaging Het
Fras1 T A 5: 96,887,124 (GRCm39) D2635E probably benign Het
Gabrb1 G A 5: 72,265,690 (GRCm39) G195E probably damaging Het
Galm A G 17: 80,457,561 (GRCm39) D199G possibly damaging Het
Galntl6 T G 8: 58,230,359 (GRCm39) S20R probably damaging Het
Grb14 T G 2: 64,768,744 (GRCm39) Y189S probably damaging Het
Hk2 T A 6: 82,705,895 (GRCm39) I803F probably damaging Het
Hmcn1 G A 1: 150,506,471 (GRCm39) R3779W probably damaging Het
Hmgcr A C 13: 96,796,403 (GRCm39) M260R probably damaging Het
Hsbp1l1 T A 18: 80,276,639 (GRCm39) K68N possibly damaging Het
Inhba A C 13: 16,192,263 (GRCm39) E128A probably benign Het
Itpr3 G A 17: 27,337,651 (GRCm39) probably benign Het
Klhl3 G A 13: 58,167,273 (GRCm39) P364S probably damaging Het
Lhpp T C 7: 132,243,312 (GRCm39) L176P probably damaging Het
Lrp1b C A 2: 40,491,599 (GRCm39) A223S probably damaging Het
Lrp3 A G 7: 34,903,489 (GRCm39) F286L probably damaging Het
Lrrc7 T C 3: 157,841,028 (GRCm39) T1337A probably benign Het
Magi2 A G 5: 20,400,019 (GRCm39) D17G probably benign Het
Map3k21 T C 8: 126,650,903 (GRCm39) S302P probably damaging Het
Matcap2 T C 9: 22,343,015 (GRCm39) M303T probably damaging Het
Mbtd1 A G 11: 93,816,511 (GRCm39) D386G probably benign Het
Mfsd2b A T 12: 4,916,820 (GRCm39) D306E possibly damaging Het
Muc20 T C 16: 32,614,453 (GRCm39) E308G probably damaging Het
Myh13 G A 11: 67,255,712 (GRCm39) S34N Het
Nebl C A 2: 17,374,421 (GRCm39) G894* probably null Het
Nelfa A G 5: 34,056,095 (GRCm39) Y523H probably damaging Het
Ninj1 A G 13: 49,341,076 (GRCm39) D13G probably benign Het
Ninl A T 2: 150,782,726 (GRCm39) S170T probably benign Het
Nlrp4c G A 7: 6,068,626 (GRCm39) V176M possibly damaging Het
Nobox G A 6: 43,284,115 (GRCm39) R144C probably damaging Het
Oas1a G A 5: 121,037,317 (GRCm39) L237F probably damaging Het
Or4a81 A C 2: 89,619,506 (GRCm39) Y63* probably null Het
Or52z15 A T 7: 103,332,477 (GRCm39) Y184F probably damaging Het
Or5w20 T C 2: 87,726,693 (GRCm39) M50T probably benign Het
Or6z1 A G 7: 6,505,150 (GRCm39) L25P probably benign Het
Or7c70 T C 10: 78,682,891 (GRCm39) N286S probably damaging Het
Or8h9 A G 2: 86,789,757 (GRCm39) M15T probably benign Het
Orai1 A G 5: 123,167,301 (GRCm39) N158S probably damaging Het
Pa2g4 C A 10: 128,398,967 (GRCm39) V121L probably benign Het
Pclo T C 5: 14,571,250 (GRCm39) S212P possibly damaging Het
Plce1 G A 19: 38,766,337 (GRCm39) E2121K possibly damaging Het
Plg A G 17: 12,622,024 (GRCm39) Y448C probably damaging Het
Plppr4 A T 3: 117,116,866 (GRCm39) N330K probably damaging Het
Pou2f2 A G 7: 24,794,247 (GRCm39) L373S probably benign Het
Rnpep A G 1: 135,211,341 (GRCm39) F136L probably benign Het
Rp1 A G 1: 4,162,838 (GRCm39) probably null Het
Shank1 G A 7: 43,962,342 (GRCm39) S71N unknown Het
Slc5a4a GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC 10: 75,986,238 (GRCm39) probably benign Het
Slc5a5 T C 8: 71,337,596 (GRCm39) D574G probably benign Het
Slc7a15 T A 12: 8,588,794 (GRCm39) N251I probably damaging Het
Speer4a3 A T 5: 26,158,136 (GRCm39) I72N probably damaging Het
Susd4 T C 1: 182,719,665 (GRCm39) S427P probably benign Het
Tarbp1 T A 8: 127,155,779 (GRCm39) T1320S probably benign Het
Tbpl2 C T 2: 23,984,650 (GRCm39) V166I probably benign Het
Thbs1 T C 2: 117,950,518 (GRCm39) probably null Het
Tnfsf13b A G 8: 10,081,648 (GRCm39) Y270C probably damaging Het
Vps11 G T 9: 44,260,290 (GRCm39) C857* probably null Het
Vsig10 G A 5: 117,463,104 (GRCm39) R110H probably benign Het
Wee2 T A 6: 40,432,044 (GRCm39) Y204* probably null Het
Zfpm2 T A 15: 40,966,867 (GRCm39) S1117R probably damaging Het
Zscan5b A G 7: 6,234,472 (GRCm39) N166S probably benign Het
Other mutations in Dusp9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02968:Dusp9 APN X 72,685,039 (GRCm39) missense probably benign 0.00
R4654:Dusp9 UTSW X 72,684,378 (GRCm39) missense probably benign 0.31
R7075:Dusp9 UTSW X 72,684,217 (GRCm39) small deletion probably benign
R7389:Dusp9 UTSW X 72,684,217 (GRCm39) small deletion probably benign
R7412:Dusp9 UTSW X 72,684,217 (GRCm39) small deletion probably benign
R7930:Dusp9 UTSW X 72,684,128 (GRCm39) small deletion probably benign
R7958:Dusp9 UTSW X 72,684,217 (GRCm39) small deletion probably benign
R8228:Dusp9 UTSW X 72,684,217 (GRCm39) small deletion probably benign
R8258:Dusp9 UTSW X 72,684,217 (GRCm39) small deletion probably benign
R8334:Dusp9 UTSW X 72,684,217 (GRCm39) small deletion probably benign
R8970:Dusp9 UTSW X 72,684,217 (GRCm39) small deletion probably benign
R9010:Dusp9 UTSW X 72,684,217 (GRCm39) small deletion probably benign
R9140:Dusp9 UTSW X 72,684,217 (GRCm39) small deletion probably benign
R9173:Dusp9 UTSW X 72,684,217 (GRCm39) small deletion probably benign
R9241:Dusp9 UTSW X 72,684,217 (GRCm39) small deletion probably benign
R9359:Dusp9 UTSW X 72,684,217 (GRCm39) small deletion probably benign
R9373:Dusp9 UTSW X 72,684,217 (GRCm39) small deletion probably benign
R9548:Dusp9 UTSW X 72,684,217 (GRCm39) small deletion probably benign
R9780:Dusp9 UTSW X 72,684,217 (GRCm39) small deletion probably benign
RF030:Dusp9 UTSW X 72,684,217 (GRCm39) small deletion probably benign
RF039:Dusp9 UTSW X 72,684,217 (GRCm39) small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AGAGTCTGAGTCGGTCATGC -3'
(R):5'- GGATCTTTTCTCCTGACCTGAGG -3'

Sequencing Primer
(F):5'- AGCTGTATGAGTCGGCGC -3'
(R):5'- TCCAGAGTGCTCTCTCAGG -3'
Posted On 2022-06-15