Incidental Mutation 'R9475:Hjurp'
ID 715680
Institutional Source Beutler Lab
Gene Symbol Hjurp
Ensembl Gene ENSMUSG00000044783
Gene Name Holliday junction recognition protein
Synonyms A730008H23Rik, C330011F01Rik, 6430706D22Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.915) question?
Stock # R9475 (G1)
Quality Score 217.468
Status Not validated
Chromosome 1
Chromosomal Location 88190193-88205355 bp(-) (GRCm39)
Type of Mutation utr 3 prime
DNA Base Change (assembly) CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT to C at 88193999 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054674] [ENSMUST00000061013] [ENSMUST00000065420] [ENSMUST00000113130] [ENSMUST00000127446] [ENSMUST00000147393]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000054674
SMART Domains Protein: ENSMUSP00000054263
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 11 68 1.5e-10 PFAM
low complexity region 159 175 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
Pfam:HJURP_mid 254 370 7.6e-54 PFAM
Pfam:HJURP_C 385 446 3.1e-26 PFAM
low complexity region 496 515 N/A INTRINSIC
Pfam:HJURP_C 527 585 7.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061013
SMART Domains Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1235 1248 N/A INTRINSIC
SCOP:d1jdha_ 1371 1669 9e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000065420
SMART Domains Protein: ENSMUSP00000070419
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 9 70 2.9e-11 PFAM
low complexity region 83 99 N/A INTRINSIC
low complexity region 139 156 N/A INTRINSIC
Pfam:HJURP_mid 178 295 7.4e-64 PFAM
Pfam:HJURP_C 309 371 1.2e-26 PFAM
low complexity region 420 439 N/A INTRINSIC
Pfam:HJURP_C 451 510 3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113130
SMART Domains Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1232 1245 N/A INTRINSIC
SCOP:d1gw5a_ 1446 1671 6e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127446
Predicted Effect probably benign
Transcript: ENSMUST00000147393
SMART Domains Protein: ENSMUSP00000120753
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 9 70 7.2e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A T 7: 45,665,892 (GRCm39) W243R probably damaging Het
Ablim1 T G 19: 57,227,612 (GRCm39) K18Q probably benign Het
Adamts18 T A 8: 114,504,570 (GRCm39) N174Y possibly damaging Het
Afg2a T C 3: 37,486,058 (GRCm39) V260A probably benign Het
Agbl2 A G 2: 90,614,437 (GRCm39) H23R probably benign Het
Akap6 T G 12: 53,057,335 (GRCm39) Y934D probably damaging Het
Alas1 C T 9: 106,111,261 (GRCm39) S635N probably benign Het
Ankrd24 A G 10: 81,478,133 (GRCm39) probably null Het
Atp6v0a4 A G 6: 38,037,917 (GRCm39) L560P probably damaging Het
Cacng1 C T 11: 107,607,118 (GRCm39) V34M possibly damaging Het
Clcn3 C T 8: 61,387,551 (GRCm39) A233T probably damaging Het
Cntnap3 A G 13: 64,946,949 (GRCm39) F160S probably damaging Het
Ctnnd2 A G 15: 30,881,276 (GRCm39) S719G probably damaging Het
Exosc2 G A 2: 31,564,755 (GRCm39) V107I probably benign Het
Fam83b C A 9: 76,399,085 (GRCm39) V673F probably benign Het
Fras1 T C 5: 96,927,929 (GRCm39) F3781L probably damaging Het
Gal3st1 T A 11: 3,948,660 (GRCm39) L289H probably damaging Het
Garem1 T C 18: 21,281,370 (GRCm39) I329V probably benign Het
Gli3 G A 13: 15,900,296 (GRCm39) G1228S possibly damaging Het
Gpbp1l1 T C 4: 116,431,558 (GRCm39) F72S possibly damaging Het
Hao1 T A 2: 134,390,181 (GRCm39) M53L probably benign Het
Iqcm A G 8: 76,480,083 (GRCm39) E347G probably damaging Het
Itpr3 G A 17: 27,337,651 (GRCm39) probably benign Het
Kcnrg A G 14: 61,845,106 (GRCm39) I49V possibly damaging Het
Lrrc8e G A 8: 4,285,346 (GRCm39) G524S probably benign Het
Lrrn1 A T 6: 107,545,261 (GRCm39) Y353F probably damaging Het
Mdn1 A G 4: 32,739,849 (GRCm39) D3701G possibly damaging Het
Mtmr2 A G 9: 13,716,767 (GRCm39) T623A probably benign Het
Ndst4 C A 3: 125,508,296 (GRCm39) S287* probably null Het
Ntrk3 A C 7: 77,952,480 (GRCm39) M579R probably benign Het
Oas1a G A 5: 121,037,317 (GRCm39) L237F probably damaging Het
Or2aj4 T C 16: 19,385,270 (GRCm39) D121G probably benign Het
Or5bw2 A T 7: 6,573,818 (GRCm39) Y276F probably damaging Het
Or7e166 T C 9: 19,624,939 (GRCm39) M272T probably benign Het
Paqr5 T A 9: 61,863,507 (GRCm39) I272F probably damaging Het
Pcdha11 T A 18: 37,140,591 (GRCm39) V740E probably damaging Het
Pdgfra A C 5: 75,328,588 (GRCm39) N240T possibly damaging Het
Plbd2 G A 5: 120,632,445 (GRCm39) Q186* probably null Het
Plce1 G A 19: 38,766,337 (GRCm39) E2121K possibly damaging Het
Ppargc1a C A 5: 51,653,080 (GRCm39) G161C probably damaging Het
Ptprk T C 10: 28,210,476 (GRCm39) I166T possibly damaging Het
Rhox8 GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT X: 36,966,991 (GRCm39) probably benign Het
Rpap2 T A 5: 107,768,455 (GRCm39) L431Q probably damaging Het
Rslcan18 T A 13: 67,250,128 (GRCm39) K160* probably null Het
Sema7a T C 9: 57,862,188 (GRCm39) F180L probably benign Het
Sh2d3c C T 2: 32,643,039 (GRCm39) L741F probably damaging Het
Shank1 G A 7: 43,962,342 (GRCm39) S71N unknown Het
Skic2 A T 17: 35,060,078 (GRCm39) D897E probably benign Het
Skint6 C T 4: 112,664,037 (GRCm39) probably null Het
Slc35f3 T C 8: 127,108,993 (GRCm39) S181P probably damaging Het
Slc4a9 A T 18: 36,662,269 (GRCm39) E127V probably null Het
Speg C T 1: 75,364,735 (GRCm39) T372I probably damaging Het
Syce1l A G 8: 114,381,735 (GRCm39) T204A probably benign Het
Tas2r138 T A 6: 40,589,392 (GRCm39) M285L probably benign Het
Tbc1d10a G C 11: 4,163,604 (GRCm39) K285N probably damaging Het
Trim9 T A 12: 70,393,228 (GRCm39) M239L probably benign Het
Trp53bp1 A G 2: 121,039,761 (GRCm39) S1293P probably benign Het
Uaca C T 9: 60,779,498 (GRCm39) T1295M possibly damaging Het
Ubald1 G T 16: 4,693,433 (GRCm39) Q161K possibly damaging Het
Ugt1a10 C T 1: 88,143,982 (GRCm39) R201C probably damaging Het
Vps45 T G 3: 95,950,237 (GRCm39) T231P probably damaging Het
Wdr17 A T 8: 55,088,512 (GRCm39) D1186E probably benign Het
Zfp534 G A 4: 147,766,731 (GRCm39) T8I probably benign Het
Zfp68 T C 5: 138,605,517 (GRCm39) N269D probably benign Het
Other mutations in Hjurp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Hjurp APN 1 88,197,991 (GRCm39) missense probably benign 0.04
IGL03099:Hjurp APN 1 88,194,011 (GRCm39) missense probably benign 0.09
BB003:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
IGL03097:Hjurp UTSW 1 88,194,002 (GRCm39) utr 3 prime probably benign
IGL03098:Hjurp UTSW 1 88,194,002 (GRCm39) utr 3 prime probably benign
IGL03147:Hjurp UTSW 1 88,194,002 (GRCm39) utr 3 prime probably benign
PIT4131001:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88,193,768 (GRCm39) missense probably damaging 0.98
PIT4142001:Hjurp UTSW 1 88,194,338 (GRCm39) missense probably benign 0.04
PIT4142001:Hjurp UTSW 1 88,194,283 (GRCm39) utr 3 prime probably benign
PIT4378001:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
PIT4812001:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R0053:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R0371:Hjurp UTSW 1 88,205,090 (GRCm39) splice site probably benign
R0442:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R0762:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R0928:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R1333:Hjurp UTSW 1 88,193,768 (GRCm39) missense probably damaging 0.98
R1342:Hjurp UTSW 1 88,205,090 (GRCm39) splice site probably benign
R1364:Hjurp UTSW 1 88,194,247 (GRCm39) frame shift probably null
R1496:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R1637:Hjurp UTSW 1 88,193,843 (GRCm39) missense probably benign 0.03
R1905:Hjurp UTSW 1 88,194,338 (GRCm39) missense probably benign 0.04
R1965:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R1992:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2002:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2023:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2024:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2332:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R2420:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2422:Hjurp UTSW 1 88,194,283 (GRCm39) utr 3 prime probably benign
R2869:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2870:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2871:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2872:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3019:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3021:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3150:Hjurp UTSW 1 88,194,283 (GRCm39) utr 3 prime probably benign
R3411:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3552:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3704:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R3730:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3733:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3764:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3799:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R3819:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R3857:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3930:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3952:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4090:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4159:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4207:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4322:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4391:Hjurp UTSW 1 88,194,283 (GRCm39) utr 3 prime probably benign
R4392:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R4393:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R4393:Hjurp UTSW 1 88,194,283 (GRCm39) utr 3 prime probably benign
R4397:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R4700:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R4808:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4900:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R4901:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5023:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R5024:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R5076:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5123:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R5236:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5300:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5318:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5370:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5410:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5445:Hjurp UTSW 1 88,194,038 (GRCm39) missense probably benign 0.43
R5457:Hjurp UTSW 1 88,194,247 (GRCm39) frame shift probably null
R5497:Hjurp UTSW 1 88,194,042 (GRCm39) missense possibly damaging 0.92
R5560:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5561:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5615:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5661:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R5722:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6087:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6089:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6090:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6125:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6175:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6362:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R6659:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R7016:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R7016:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R7045:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R7179:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R7200:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R7463:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R7912:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R8215:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R8968:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R9038:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R9115:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R9133:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R9146:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R9221:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R9482:Hjurp UTSW 1 88,193,996 (GRCm39) utr 3 prime probably benign
R9565:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R9599:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
V5622:Hjurp UTSW 1 88,205,247 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TAAGTCCAAGTCCTTCTGCGG -3'
(R):5'- GCAATGTGACAATCAGCGATTTG -3'

Sequencing Primer
(F):5'- CTTCTGCGGCATCATCTGGAG -3'
(R):5'- CAATCAGCGATTTGTATGAAGGC -3'
Posted On 2022-06-15