Mutagenetix > Incidental Mutation

Incidental Mutation 'R9475:Trp53bp1'

715684

Institutional Source

Beutler Lab

Gene Symbol

Trp53bp1

Ensembl Gene

ENSMUSG00000043909

Gene Name

transformation related protein 53 binding protein 1

Synonyms

53BP1, p53BP1

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9475 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

121193281-121271407 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 121209280 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1293 (S1293P)

Ref Sequence

ENSEMBL: ENSMUSP00000106277 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110647] [ENSMUST00000110648] [ENSMUST00000154426]

AlphaFold

P70399

Predicted Effect

probably benign
Transcript: ENSMUST00000110647
AA Change: S1293P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000106277
Gene: ENSMUSG00000043909
AA Change: S1293P

Domain	Start	End	E-Value	Type
low complexity region	136	149	N/A	INTRINSIC
low complexity region	158	169	N/A	INTRINSIC
low complexity region	647	661	N/A	INTRINSIC
low complexity region	1031	1042	N/A	INTRINSIC
low complexity region	1099	1112	N/A	INTRINSIC
low complexity region	1260	1272	N/A	INTRINSIC
low complexity region	1290	1332	N/A	INTRINSIC
Pfam:53-BP1_Tudor	1430	1551	2.5e-80	PFAM
low complexity region	1581	1601	N/A	INTRINSIC
BRCT	1673	1785	7.13e-1	SMART
BRCT	1813	1901	1.03e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110648
AA Change: S1293P

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000106278
Gene: ENSMUSG00000043909
AA Change: S1293P

Domain	Start	End	E-Value	Type
low complexity region	136	149	N/A	INTRINSIC
low complexity region	158	169	N/A	INTRINSIC
low complexity region	647	661	N/A	INTRINSIC
low complexity region	1031	1042	N/A	INTRINSIC
low complexity region	1099	1112	N/A	INTRINSIC
low complexity region	1260	1272	N/A	INTRINSIC
low complexity region	1290	1332	N/A	INTRINSIC
low complexity region	1389	1409	N/A	INTRINSIC
Pfam:53-BP1_Tudor	1480	1601	1.5e-80	PFAM
low complexity region	1631	1651	N/A	INTRINSIC
BRCT	1723	1835	7.13e-1	SMART
BRCT	1863	1951	1.03e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000124554

Predicted Effect

probably benign
Transcript: ENSMUST00000147540

Predicted Effect

probably benign
Transcript: ENSMUST00000154426

SMART Domains

Protein: ENSMUSP00000117548
Gene: ENSMUSG00000043909

Domain	Start	End	E-Value	Type
Pfam:53-BP1_Tudor	1	70	2.5e-44	PFAM
low complexity region	100	120	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.5%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous mutations in this gene result in growth retardation, immunodeficiency, thymic hypoplasia, and increased incidence of thymic lymphomas. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc6	A	T	7: 46,016,468	W243R	probably damaging	Het
Ablim1	T	G	19: 57,239,180	K18Q	probably benign	Het
Adamts18	T	A	8: 113,777,938	N174Y	possibly damaging	Het
Agbl2	A	G	2: 90,784,093	H23R	probably benign	Het
Akap6	T	G	12: 53,010,552	Y934D	probably damaging	Het
Alas1	C	T	9: 106,234,062	S635N	probably benign	Het
Ankrd24	A	G	10: 81,642,299		probably null	Het
Atp6v0a4	A	G	6: 38,060,982	L560P	probably damaging	Het
Cacng1	C	T	11: 107,716,292	V34M	possibly damaging	Het
Clcn3	C	T	8: 60,934,517	A233T	probably damaging	Het
Cntnap3	A	G	13: 64,799,135	F160S	probably damaging	Het
Ctnnd2	A	G	15: 30,881,130	S719G	probably damaging	Het
Exosc2	G	A	2: 31,674,743	V107I	probably benign	Het
Fam83b	C	A	9: 76,491,803	V673F	probably benign	Het
Fras1	T	C	5: 96,780,070	F3781L	probably damaging	Het
Gal3st1	T	A	11: 3,998,660	L289H	probably damaging	Het
Garem1	T	C	18: 21,148,313	I329V	probably benign	Het
Gli3	G	A	13: 15,725,711	G1228S	possibly damaging	Het
Gpbp1l1	T	C	4: 116,574,361	F72S	possibly damaging	Het
Hao1	T	A	2: 134,548,261	M53L	probably benign	Het
Hjurp	CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT	C	1: 88,266,277		probably benign	Het
Iqcm	A	G	8: 75,753,455	E347G	probably damaging	Het
Itpr3	G	A	17: 27,118,677		probably benign	Het
Kcnrg	A	G	14: 61,607,657	I49V	possibly damaging	Het
Lrrc8e	G	A	8: 4,235,346	G524S	probably benign	Het
Lrrn1	A	T	6: 107,568,300	Y353F	probably damaging	Het
Mdn1	A	G	4: 32,739,849	D3701G	possibly damaging	Het
Mtmr2	A	G	9: 13,805,471	T623A	probably benign	Het
Ndst4	C	A	3: 125,714,647	S287*	probably null	Het
Ntrk3	A	C	7: 78,302,732	M579R	probably benign	Het
Oas1a	G	A	5: 120,899,254	L237F	probably damaging	Het
Olfr1350	A	T	7: 6,570,819	Y276F	probably damaging	Het
Olfr169	T	C	16: 19,566,520	D121G	probably benign	Het
Olfr857	T	C	9: 19,713,643	M272T	probably benign	Het
Paqr5	T	A	9: 61,956,225	I272F	probably damaging	Het
Pcdha11	T	A	18: 37,007,538	V740E	probably damaging	Het
Pdgfra	A	C	5: 75,167,927	N240T	possibly damaging	Het
Plbd2	G	A	5: 120,494,380	Q186*	probably null	Het
Plce1	G	A	19: 38,777,893	E2121K	possibly damaging	Het
Ppargc1a	C	A	5: 51,495,738	G161C	probably damaging	Het
Ptprk	T	C	10: 28,334,480	I166T	possibly damaging	Het
Rhox8	GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT	GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT	X: 37,878,114		probably benign	Het
Rpap2	T	A	5: 107,620,589	L431Q	probably damaging	Het
Rslcan18	T	A	13: 67,102,064	K160*	probably null	Het
Sema7a	T	C	9: 57,954,905	F180L	probably benign	Het
Sh2d3c	C	T	2: 32,753,027	L741F	probably damaging	Het
Shank1	G	A	7: 44,312,918	S71N	unknown	Het
Skint6	C	T	4: 112,806,840		probably null	Het
Skiv2l	A	T	17: 34,841,102	D897E	probably benign	Het
Slc35f3	T	C	8: 126,382,254	S181P	probably damaging	Het
Slc4a9	A	T	18: 36,529,216	E127V	probably null	Het
Spata5	T	C	3: 37,431,909	V260A	probably benign	Het
Speg	C	T	1: 75,388,091	T372I	probably damaging	Het
Syce1l	A	G	8: 113,655,103	T204A	probably benign	Het
Tas2r138	T	A	6: 40,612,458	M285L	probably benign	Het
Tbc1d10a	G	C	11: 4,213,604	K285N	probably damaging	Het
Trim9	T	A	12: 70,346,454	M239L	probably benign	Het
Uaca	C	T	9: 60,872,216	T1295M	possibly damaging	Het
Ubald1	G	T	16: 4,875,569	Q161K	possibly damaging	Het
Ugt1a10	C	T	1: 88,216,260	R201C	probably damaging	Het
Vps45	T	G	3: 96,042,925	T231P	probably damaging	Het
Wdr17	A	T	8: 54,635,477	D1186E	probably benign	Het
Zfp534	G	A	4: 147,682,274	T8I	probably benign	Het
Zfp68	T	C	5: 138,607,255	N269D	probably benign	Het

Other mutations in Trp53bp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Trp53bp1	APN	2	121256579	missense	possibly damaging	0.69
IGL00690:Trp53bp1	APN	2	121235995	missense	probably damaging	1.00
IGL00922:Trp53bp1	APN	2	121208482	missense	probably damaging	0.96
IGL01475:Trp53bp1	APN	2	121270319	splice site	probably null
IGL01639:Trp53bp1	APN	2	121202692	missense	possibly damaging	0.51
IGL01662:Trp53bp1	APN	2	121236025	missense	probably damaging	1.00
IGL01757:Trp53bp1	APN	2	121211304	missense	probably damaging	0.99
IGL01829:Trp53bp1	APN	2	121215896	missense	probably benign	0.39
IGL02247:Trp53bp1	APN	2	121236589	missense	probably damaging	1.00
IGL02349:Trp53bp1	APN	2	121199074	missense	probably damaging	1.00
IGL02391:Trp53bp1	APN	2	121202710	missense	possibly damaging	0.67
chives	UTSW	2	121251868	missense	probably null	0.13
concur	UTSW	2	121270319	splice site	probably null
confirmation	UTSW	2	121205113	critical splice acceptor site	probably null
Infra	UTSW	2	121247499	critical splice donor site	probably null
Legume	UTSW	2	121199042	missense	probably damaging	0.99
lentil	UTSW	2	121251868	missense	probably null	0.13
lentil2	UTSW	2	121207887	missense	probably damaging	1.00
Profundus	UTSW	2	121207803	missense	probably damaging	1.00
split_pea	UTSW	2	121228606	nonsense	probably null
verily	UTSW	2	121211313	missense	probably damaging	1.00
PIT1430001:Trp53bp1	UTSW	2	121271275	missense	probably damaging	1.00
R0045:Trp53bp1	UTSW	2	121204497	missense	probably benign
R0060:Trp53bp1	UTSW	2	121204525	missense	probably damaging	1.00
R0060:Trp53bp1	UTSW	2	121204525	missense	probably damaging	1.00
R0103:Trp53bp1	UTSW	2	121236759	missense	possibly damaging	0.92
R0103:Trp53bp1	UTSW	2	121236759	missense	possibly damaging	0.92
R0281:Trp53bp1	UTSW	2	121270237	missense	probably damaging	1.00
R0386:Trp53bp1	UTSW	2	121204943	missense	probably damaging	1.00
R0427:Trp53bp1	UTSW	2	121236017	missense	probably damaging	1.00
R0505:Trp53bp1	UTSW	2	121269969	missense	probably damaging	0.99
R0522:Trp53bp1	UTSW	2	121251868	missense	probably null	0.13
R0523:Trp53bp1	UTSW	2	121251868	missense	probably null	0.13
R0525:Trp53bp1	UTSW	2	121251868	missense	probably null	0.13
R0543:Trp53bp1	UTSW	2	121251868	missense	probably null	0.13
R0559:Trp53bp1	UTSW	2	121227801	missense	probably damaging	1.00
R0573:Trp53bp1	UTSW	2	121228172	splice site	probably benign
R0593:Trp53bp1	UTSW	2	121270528	missense	possibly damaging	0.95
R0648:Trp53bp1	UTSW	2	121235707	missense	probably benign	0.20
R0680:Trp53bp1	UTSW	2	121251868	missense	probably null	0.13
R0732:Trp53bp1	UTSW	2	121248264	missense	probably null	0.96
R0905:Trp53bp1	UTSW	2	121204318	splice site	probably benign
R1377:Trp53bp1	UTSW	2	121270642	missense	probably damaging	1.00
R1415:Trp53bp1	UTSW	2	121236184	missense	probably damaging	1.00
R1725:Trp53bp1	UTSW	2	121252000	missense	possibly damaging	0.46
R1971:Trp53bp1	UTSW	2	121205036	missense	probably damaging	1.00
R2045:Trp53bp1	UTSW	2	121204483	missense	probably benign
R2143:Trp53bp1	UTSW	2	121216064	missense	probably benign	0.00
R2282:Trp53bp1	UTSW	2	121270273	nonsense	probably null
R2296:Trp53bp1	UTSW	2	121209247	missense	possibly damaging	0.96
R3106:Trp53bp1	UTSW	2	121236652	missense	probably damaging	1.00
R3792:Trp53bp1	UTSW	2	121200329	missense	probably damaging	1.00
R3793:Trp53bp1	UTSW	2	121200329	missense	probably damaging	1.00
R3946:Trp53bp1	UTSW	2	121228626	missense	probably damaging	0.99
R4001:Trp53bp1	UTSW	2	121205085	missense	probably damaging	1.00
R4327:Trp53bp1	UTSW	2	121256650	missense	probably damaging	1.00
R4585:Trp53bp1	UTSW	2	121207951	missense	probably damaging	1.00
R4630:Trp53bp1	UTSW	2	121207887	missense	probably damaging	1.00
R4744:Trp53bp1	UTSW	2	121211313	missense	probably damaging	1.00
R4751:Trp53bp1	UTSW	2	121227809	missense	probably damaging	1.00
R4754:Trp53bp1	UTSW	2	121207879	missense	probably damaging	1.00
R4755:Trp53bp1	UTSW	2	121228606	nonsense	probably null
R4850:Trp53bp1	UTSW	2	121205113	critical splice acceptor site	probably null
R4870:Trp53bp1	UTSW	2	121256641	missense	probably damaging	1.00
R4879:Trp53bp1	UTSW	2	121202603	missense	probably damaging	0.99
R4924:Trp53bp1	UTSW	2	121221220	nonsense	probably null
R4962:Trp53bp1	UTSW	2	121270546	missense	probably benign	0.12
R5019:Trp53bp1	UTSW	2	121270319	splice site	probably null
R5111:Trp53bp1	UTSW	2	121211387	missense	probably damaging	0.99
R5149:Trp53bp1	UTSW	2	121216117	missense	probably benign	0.00
R5252:Trp53bp1	UTSW	2	121243983	missense	probably benign	0.40
R5533:Trp53bp1	UTSW	2	121207746	missense	probably damaging	1.00
R5642:Trp53bp1	UTSW	2	121236662	missense	probably benign	0.00
R5773:Trp53bp1	UTSW	2	121243914	missense	probably damaging	1.00
R5819:Trp53bp1	UTSW	2	121208392	nonsense	probably null
R5886:Trp53bp1	UTSW	2	121205021	missense	probably damaging	1.00
R5908:Trp53bp1	UTSW	2	121236823	missense	probably benign	0.06
R6012:Trp53bp1	UTSW	2	121256602	missense	probably benign	0.07
R6351:Trp53bp1	UTSW	2	121269945	missense	probably damaging	1.00
R6406:Trp53bp1	UTSW	2	121270612	missense	probably damaging	0.99
R6575:Trp53bp1	UTSW	2	121228603	missense	probably damaging	1.00
R6619:Trp53bp1	UTSW	2	121247499	critical splice donor site	probably null
R6626:Trp53bp1	UTSW	2	121207803	missense	probably damaging	1.00
R6754:Trp53bp1	UTSW	2	121270576	missense	possibly damaging	0.83
R6765:Trp53bp1	UTSW	2	121209309	missense	probably damaging	1.00
R6806:Trp53bp1	UTSW	2	121228666	missense	probably damaging	0.99
R6860:Trp53bp1	UTSW	2	121199113	missense	probably damaging	1.00
R6991:Trp53bp1	UTSW	2	121208040	missense	probably damaging	1.00
R7278:Trp53bp1	UTSW	2	121199035	missense	probably damaging	1.00
R7339:Trp53bp1	UTSW	2	121236469	missense	probably benign	0.00
R7357:Trp53bp1	UTSW	2	121211300	missense	probably damaging	1.00
R7477:Trp53bp1	UTSW	2	121236346	missense	probably benign	0.34
R7577:Trp53bp1	UTSW	2	121236638	missense	possibly damaging	0.65
R7643:Trp53bp1	UTSW	2	121247814	splice site	probably null
R7728:Trp53bp1	UTSW	2	121207899	missense	probably damaging	1.00
R7806:Trp53bp1	UTSW	2	121205061	missense	probably damaging	0.99
R7955:Trp53bp1	UTSW	2	121235744	missense	possibly damaging	0.59
R8099:Trp53bp1	UTSW	2	121199749	missense	probably damaging	1.00
R8200:Trp53bp1	UTSW	2	121236176	missense	probably benign	0.00
R8282:Trp53bp1	UTSW	2	121199042	missense	probably damaging	0.99
R9136:Trp53bp1	UTSW	2	121236611	missense	possibly damaging	0.84
R9152:Trp53bp1	UTSW	2	121198575	missense	probably damaging	0.99
R9292:Trp53bp1	UTSW	2	121215696	missense	probably damaging	0.97
R9340:Trp53bp1	UTSW	2	121269979	missense	probably benign	0.40
R9616:Trp53bp1	UTSW	2	121236176	missense	probably benign	0.30
R9675:Trp53bp1	UTSW	2	121256608	missense	probably benign	0.03
R9779:Trp53bp1	UTSW	2	121235988	missense	probably damaging	1.00
RF046:Trp53bp1	UTSW	2	121216001	frame shift	probably null
Z1088:Trp53bp1	UTSW	2	121253645	missense	probably benign	0.04
Z1177:Trp53bp1	UTSW	2	121244060	missense	probably benign	0.33

Predicted Primers

PCR Primer
(F):5'- TCTGGAGAACCTGTCTGCAC -3'
(R):5'- CACCTGGCTGATAGGACATTTCC -3'

Sequencing Primer
(F):5'- GAGAACCTGTCTGCACCTCAG -3'
(R):5'- GGACATTTCCTGCAGTCTCTGG -3'

Posted On

2022-06-15