Incidental Mutation 'R9475:Atp6v0a4'
ID 715700
Institutional Source Beutler Lab
Gene Symbol Atp6v0a4
Ensembl Gene ENSMUSG00000038600
Gene Name ATPase, H+ transporting, lysosomal V0 subunit A4
Synonyms V-ATPase alpha 4, Atp6n1b
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9475 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 38048483-38124586 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 38060982 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 560 (L560P)
Ref Sequence ENSEMBL: ENSMUSP00000039381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040259] [ENSMUST00000114908]
AlphaFold Q920R6
Predicted Effect probably damaging
Transcript: ENSMUST00000040259
AA Change: L560P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039381
Gene: ENSMUSG00000038600
AA Change: L560P

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 824 3.5e-293 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114908
AA Change: L560P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110558
Gene: ENSMUSG00000038600
AA Change: L560P

DomainStartEndE-ValueType
Pfam:V_ATPase_I 27 823 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of intracellular compartments of eukaryotic cells. V-ATPase dependent acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c'', and d. This gene is one of four genes in man and mouse that encode different isoforms of the a subunit. Alternatively spliced transcript variants encoding the same protein have been described. Mutations in this gene are associated with renal tubular acidosis associated with preserved hearing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display postnatal or premature lethality, hyperchloremic hypokalemic acidosis with hypocitraturia, inner ear defects, impaired hearing, and impaired olfaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A T 7: 46,016,468 W243R probably damaging Het
Ablim1 T G 19: 57,239,180 K18Q probably benign Het
Adamts18 T A 8: 113,777,938 N174Y possibly damaging Het
Agbl2 A G 2: 90,784,093 H23R probably benign Het
Akap6 T G 12: 53,010,552 Y934D probably damaging Het
Alas1 C T 9: 106,234,062 S635N probably benign Het
Ankrd24 A G 10: 81,642,299 probably null Het
Cacng1 C T 11: 107,716,292 V34M possibly damaging Het
Clcn3 C T 8: 60,934,517 A233T probably damaging Het
Cntnap3 A G 13: 64,799,135 F160S probably damaging Het
Ctnnd2 A G 15: 30,881,130 S719G probably damaging Het
Exosc2 G A 2: 31,674,743 V107I probably benign Het
Fam83b C A 9: 76,491,803 V673F probably benign Het
Fras1 T C 5: 96,780,070 F3781L probably damaging Het
Gal3st1 T A 11: 3,998,660 L289H probably damaging Het
Garem1 T C 18: 21,148,313 I329V probably benign Het
Gli3 G A 13: 15,725,711 G1228S possibly damaging Het
Gpbp1l1 T C 4: 116,574,361 F72S possibly damaging Het
Hao1 T A 2: 134,548,261 M53L probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Iqcm A G 8: 75,753,455 E347G probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kcnrg A G 14: 61,607,657 I49V possibly damaging Het
Lrrc8e G A 8: 4,235,346 G524S probably benign Het
Lrrn1 A T 6: 107,568,300 Y353F probably damaging Het
Mdn1 A G 4: 32,739,849 D3701G possibly damaging Het
Mtmr2 A G 9: 13,805,471 T623A probably benign Het
Ndst4 C A 3: 125,714,647 S287* probably null Het
Ntrk3 A C 7: 78,302,732 M579R probably benign Het
Oas1a G A 5: 120,899,254 L237F probably damaging Het
Olfr1350 A T 7: 6,570,819 Y276F probably damaging Het
Olfr169 T C 16: 19,566,520 D121G probably benign Het
Olfr857 T C 9: 19,713,643 M272T probably benign Het
Paqr5 T A 9: 61,956,225 I272F probably damaging Het
Pcdha11 T A 18: 37,007,538 V740E probably damaging Het
Pdgfra A C 5: 75,167,927 N240T possibly damaging Het
Plbd2 G A 5: 120,494,380 Q186* probably null Het
Plce1 G A 19: 38,777,893 E2121K possibly damaging Het
Ppargc1a C A 5: 51,495,738 G161C probably damaging Het
Ptprk T C 10: 28,334,480 I166T possibly damaging Het
Rhox8 GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT X: 37,878,114 probably benign Het
Rpap2 T A 5: 107,620,589 L431Q probably damaging Het
Rslcan18 T A 13: 67,102,064 K160* probably null Het
Sema7a T C 9: 57,954,905 F180L probably benign Het
Sh2d3c C T 2: 32,753,027 L741F probably damaging Het
Shank1 G A 7: 44,312,918 S71N unknown Het
Skint6 C T 4: 112,806,840 probably null Het
Skiv2l A T 17: 34,841,102 D897E probably benign Het
Slc35f3 T C 8: 126,382,254 S181P probably damaging Het
Slc4a9 A T 18: 36,529,216 E127V probably null Het
Spata5 T C 3: 37,431,909 V260A probably benign Het
Speg C T 1: 75,388,091 T372I probably damaging Het
Syce1l A G 8: 113,655,103 T204A probably benign Het
Tas2r138 T A 6: 40,612,458 M285L probably benign Het
Tbc1d10a G C 11: 4,213,604 K285N probably damaging Het
Trim9 T A 12: 70,346,454 M239L probably benign Het
Trp53bp1 A G 2: 121,209,280 S1293P probably benign Het
Uaca C T 9: 60,872,216 T1295M possibly damaging Het
Ubald1 G T 16: 4,875,569 Q161K possibly damaging Het
Ugt1a10 C T 1: 88,216,260 R201C probably damaging Het
Vps45 T G 3: 96,042,925 T231P probably damaging Het
Wdr17 A T 8: 54,635,477 D1186E probably benign Het
Zfp534 G A 4: 147,682,274 T8I probably benign Het
Zfp68 T C 5: 138,607,255 N269D probably benign Het
Other mutations in Atp6v0a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Atp6v0a4 APN 6 38092790 nonsense probably null
IGL01358:Atp6v0a4 APN 6 38074210 missense probably damaging 1.00
IGL01781:Atp6v0a4 APN 6 38074160 missense possibly damaging 0.91
IGL01934:Atp6v0a4 APN 6 38051546 missense possibly damaging 0.90
IGL01953:Atp6v0a4 APN 6 38054617 missense probably damaging 0.97
IGL03190:Atp6v0a4 APN 6 38054556 missense probably benign 0.02
R0049:Atp6v0a4 UTSW 6 38082081 missense probably damaging 1.00
R0049:Atp6v0a4 UTSW 6 38082081 missense probably damaging 1.00
R0100:Atp6v0a4 UTSW 6 38076815 missense probably benign
R0105:Atp6v0a4 UTSW 6 38053129 splice site probably benign
R1569:Atp6v0a4 UTSW 6 38050625 missense probably damaging 1.00
R1754:Atp6v0a4 UTSW 6 38067829 missense probably benign
R2142:Atp6v0a4 UTSW 6 38082936 nonsense probably null
R2162:Atp6v0a4 UTSW 6 38088646 missense possibly damaging 0.89
R2433:Atp6v0a4 UTSW 6 38082029 critical splice donor site probably null
R2892:Atp6v0a4 UTSW 6 38053017 missense probably benign 0.00
R4599:Atp6v0a4 UTSW 6 38078802 missense probably benign 0.01
R4687:Atp6v0a4 UTSW 6 38092465 missense possibly damaging 0.95
R4716:Atp6v0a4 UTSW 6 38061064 missense probably damaging 1.00
R4938:Atp6v0a4 UTSW 6 38078814 missense possibly damaging 0.80
R5062:Atp6v0a4 UTSW 6 38074183 missense probably benign 0.05
R5437:Atp6v0a4 UTSW 6 38076733 missense probably damaging 0.97
R5440:Atp6v0a4 UTSW 6 38092817 missense probably damaging 0.96
R5697:Atp6v0a4 UTSW 6 38050507 splice site probably null
R5698:Atp6v0a4 UTSW 6 38050507 splice site probably null
R6425:Atp6v0a4 UTSW 6 38050511 missense possibly damaging 0.88
R7659:Atp6v0a4 UTSW 6 38071972 missense probably damaging 1.00
R8004:Atp6v0a4 UTSW 6 38050549 missense possibly damaging 0.93
R8270:Atp6v0a4 UTSW 6 38074229 missense probably damaging 1.00
R8683:Atp6v0a4 UTSW 6 38048991 makesense probably null
R9007:Atp6v0a4 UTSW 6 38053053 missense probably benign
R9359:Atp6v0a4 UTSW 6 38082113 missense probably benign 0.21
Z1176:Atp6v0a4 UTSW 6 38049036 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCCTCATCAGTGCCATCAGG -3'
(R):5'- GGAGCTCTCTGTAGCTGCTTTC -3'

Sequencing Primer
(F):5'- GTAGAAGATGGCTCATCAGTCCTC -3'
(R):5'- AGCTGCTTTCTGTGCTGTATC -3'
Posted On 2022-06-15