Incidental Mutation 'R9475:Abcc6'
ID 715705
Institutional Source Beutler Lab
Gene Symbol Abcc6
Ensembl Gene ENSMUSG00000030834
Gene Name ATP-binding cassette, sub-family C (CFTR/MRP), member 6
Synonyms Mrp6, DCC, Dyscalc1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.790) question?
Stock # R9475 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 45967555-46030302 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 46016468 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 243 (W243R)
Ref Sequence ENSEMBL: ENSMUSP00000002850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002850]
AlphaFold Q9R1S7
Predicted Effect probably damaging
Transcript: ENSMUST00000002850
AA Change: W243R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000002850
Gene: ENSMUSG00000030834
AA Change: W243R

DomainStartEndE-ValueType
transmembrane domain 44 61 N/A INTRINSIC
transmembrane domain 81 100 N/A INTRINSIC
transmembrane domain 110 129 N/A INTRINSIC
transmembrane domain 142 161 N/A INTRINSIC
transmembrane domain 171 193 N/A INTRINSIC
Pfam:ABC_membrane 309 580 3.5e-29 PFAM
AAA 653 828 1.19e-9 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:ABC_membrane 942 1211 2.5e-32 PFAM
AAA 1286 1473 1.71e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The specific function of this protein is unknown; however, a similar rat protein has been identified as the major canalicular bile salt export pump of liver. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display patchy mineralization which may include the capsule surrounding the sinuses of vibrissae, medium sized arteries, skin, retina, kidney, and interscapular brown fat. Strain differences at this locus may lead to altered susceptibility to cardiac calcinosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T G 19: 57,239,180 K18Q probably benign Het
Adamts18 T A 8: 113,777,938 N174Y possibly damaging Het
Agbl2 A G 2: 90,784,093 H23R probably benign Het
Akap6 T G 12: 53,010,552 Y934D probably damaging Het
Alas1 C T 9: 106,234,062 S635N probably benign Het
Ankrd24 A G 10: 81,642,299 probably null Het
Atp6v0a4 A G 6: 38,060,982 L560P probably damaging Het
Cacng1 C T 11: 107,716,292 V34M possibly damaging Het
Clcn3 C T 8: 60,934,517 A233T probably damaging Het
Cntnap3 A G 13: 64,799,135 F160S probably damaging Het
Ctnnd2 A G 15: 30,881,130 S719G probably damaging Het
Exosc2 G A 2: 31,674,743 V107I probably benign Het
Fam83b C A 9: 76,491,803 V673F probably benign Het
Fras1 T C 5: 96,780,070 F3781L probably damaging Het
Gal3st1 T A 11: 3,998,660 L289H probably damaging Het
Garem1 T C 18: 21,148,313 I329V probably benign Het
Gli3 G A 13: 15,725,711 G1228S possibly damaging Het
Gpbp1l1 T C 4: 116,574,361 F72S possibly damaging Het
Hao1 T A 2: 134,548,261 M53L probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Iqcm A G 8: 75,753,455 E347G probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kcnrg A G 14: 61,607,657 I49V possibly damaging Het
Lrrc8e G A 8: 4,235,346 G524S probably benign Het
Lrrn1 A T 6: 107,568,300 Y353F probably damaging Het
Mdn1 A G 4: 32,739,849 D3701G possibly damaging Het
Mtmr2 A G 9: 13,805,471 T623A probably benign Het
Ndst4 C A 3: 125,714,647 S287* probably null Het
Ntrk3 A C 7: 78,302,732 M579R probably benign Het
Oas1a G A 5: 120,899,254 L237F probably damaging Het
Olfr1350 A T 7: 6,570,819 Y276F probably damaging Het
Olfr169 T C 16: 19,566,520 D121G probably benign Het
Olfr857 T C 9: 19,713,643 M272T probably benign Het
Paqr5 T A 9: 61,956,225 I272F probably damaging Het
Pcdha11 T A 18: 37,007,538 V740E probably damaging Het
Pdgfra A C 5: 75,167,927 N240T possibly damaging Het
Plbd2 G A 5: 120,494,380 Q186* probably null Het
Plce1 G A 19: 38,777,893 E2121K possibly damaging Het
Ppargc1a C A 5: 51,495,738 G161C probably damaging Het
Ptprk T C 10: 28,334,480 I166T possibly damaging Het
Rhox8 GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT X: 37,878,114 probably benign Het
Rpap2 T A 5: 107,620,589 L431Q probably damaging Het
Rslcan18 T A 13: 67,102,064 K160* probably null Het
Sema7a T C 9: 57,954,905 F180L probably benign Het
Sh2d3c C T 2: 32,753,027 L741F probably damaging Het
Shank1 G A 7: 44,312,918 S71N unknown Het
Skint6 C T 4: 112,806,840 probably null Het
Skiv2l A T 17: 34,841,102 D897E probably benign Het
Slc35f3 T C 8: 126,382,254 S181P probably damaging Het
Slc4a9 A T 18: 36,529,216 E127V probably null Het
Spata5 T C 3: 37,431,909 V260A probably benign Het
Speg C T 1: 75,388,091 T372I probably damaging Het
Syce1l A G 8: 113,655,103 T204A probably benign Het
Tas2r138 T A 6: 40,612,458 M285L probably benign Het
Tbc1d10a G C 11: 4,213,604 K285N probably damaging Het
Trim9 T A 12: 70,346,454 M239L probably benign Het
Trp53bp1 A G 2: 121,209,280 S1293P probably benign Het
Uaca C T 9: 60,872,216 T1295M possibly damaging Het
Ubald1 G T 16: 4,875,569 Q161K possibly damaging Het
Ugt1a10 C T 1: 88,216,260 R201C probably damaging Het
Vps45 T G 3: 96,042,925 T231P probably damaging Het
Wdr17 A T 8: 54,635,477 D1186E probably benign Het
Zfp534 G A 4: 147,682,274 T8I probably benign Het
Zfp68 T C 5: 138,607,255 N269D probably benign Het
Other mutations in Abcc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Abcc6 APN 7 46002672 splice site probably benign
IGL01731:Abcc6 APN 7 46002610 missense possibly damaging 0.71
IGL01743:Abcc6 APN 7 45996814 missense probably benign 0.02
IGL01757:Abcc6 APN 7 45990281 splice site probably benign
IGL01895:Abcc6 APN 7 46029058 missense possibly damaging 0.88
IGL01942:Abcc6 APN 7 45986573 missense possibly damaging 0.89
IGL02251:Abcc6 APN 7 45977416 missense probably damaging 1.00
IGL02277:Abcc6 APN 7 46001061 missense probably benign 0.00
IGL02548:Abcc6 APN 7 46005262 missense probably damaging 0.98
IGL03063:Abcc6 APN 7 46016432 missense probably benign
IGL03092:Abcc6 APN 7 45986470 missense probably damaging 1.00
IGL03251:Abcc6 APN 7 45982237 unclassified probably benign
R0057:Abcc6 UTSW 7 46020143 missense probably benign 0.03
R0944:Abcc6 UTSW 7 46015505 missense possibly damaging 0.81
R1019:Abcc6 UTSW 7 46014107 missense possibly damaging 0.77
R1183:Abcc6 UTSW 7 45985253 missense probably damaging 0.99
R1543:Abcc6 UTSW 7 46016504 missense probably benign 0.01
R1550:Abcc6 UTSW 7 46005244 missense probably benign 0.25
R1725:Abcc6 UTSW 7 45992357 missense possibly damaging 0.76
R1907:Abcc6 UTSW 7 46014169 missense probably benign 0.04
R1908:Abcc6 UTSW 7 46020134 splice site probably null
R1909:Abcc6 UTSW 7 46020134 splice site probably null
R2138:Abcc6 UTSW 7 45981051 missense probably damaging 1.00
R2145:Abcc6 UTSW 7 45998741 missense probably benign 0.01
R2402:Abcc6 UTSW 7 46015575 missense probably benign 0.04
R3983:Abcc6 UTSW 7 45995289 missense probably benign
R4013:Abcc6 UTSW 7 46018680 missense probably benign 0.01
R4051:Abcc6 UTSW 7 45986563 missense probably damaging 1.00
R4052:Abcc6 UTSW 7 45986563 missense probably damaging 1.00
R4208:Abcc6 UTSW 7 45986563 missense probably damaging 1.00
R4362:Abcc6 UTSW 7 45998832 splice site probably benign
R4385:Abcc6 UTSW 7 45995328 missense possibly damaging 0.93
R4399:Abcc6 UTSW 7 46002607 missense probably benign
R4479:Abcc6 UTSW 7 46005239 missense possibly damaging 0.60
R4480:Abcc6 UTSW 7 46005239 missense possibly damaging 0.60
R4780:Abcc6 UTSW 7 45996691 missense probably benign
R4791:Abcc6 UTSW 7 45982160 missense probably benign 0.00
R4895:Abcc6 UTSW 7 45980990 missense possibly damaging 0.95
R4898:Abcc6 UTSW 7 45989687 missense probably damaging 0.96
R4905:Abcc6 UTSW 7 45995225 missense probably benign
R4941:Abcc6 UTSW 7 46012523 missense probably benign 0.00
R5040:Abcc6 UTSW 7 46020154 missense probably benign 0.04
R5128:Abcc6 UTSW 7 45989646 missense probably benign 0.00
R5284:Abcc6 UTSW 7 45981059 missense probably benign 0.05
R5328:Abcc6 UTSW 7 45992311 missense probably benign 0.01
R5459:Abcc6 UTSW 7 45982183 missense probably benign 0.00
R5543:Abcc6 UTSW 7 45989536 critical splice donor site probably null
R6178:Abcc6 UTSW 7 46029044 missense probably benign
R6228:Abcc6 UTSW 7 46030256 missense probably benign 0.02
R6532:Abcc6 UTSW 7 45977379 missense probably damaging 1.00
R6605:Abcc6 UTSW 7 45981057 missense probably damaging 1.00
R7000:Abcc6 UTSW 7 46005522 missense possibly damaging 0.60
R7067:Abcc6 UTSW 7 46018690 missense probably benign
R7553:Abcc6 UTSW 7 45999121 missense probably damaging 1.00
R7597:Abcc6 UTSW 7 45995237 missense probably damaging 1.00
R7718:Abcc6 UTSW 7 45977392 missense possibly damaging 0.91
R7781:Abcc6 UTSW 7 46005606 missense probably damaging 1.00
R7798:Abcc6 UTSW 7 45976853 nonsense probably null
R7896:Abcc6 UTSW 7 45977379 missense probably damaging 1.00
R8098:Abcc6 UTSW 7 45996665 missense probably damaging 1.00
R8443:Abcc6 UTSW 7 45980025 missense probably damaging 1.00
R8773:Abcc6 UTSW 7 45985145 missense probably benign
R8784:Abcc6 UTSW 7 46002601 missense probably benign
R8802:Abcc6 UTSW 7 46008859 missense probably damaging 0.99
R8807:Abcc6 UTSW 7 45999007 missense possibly damaging 0.67
R9006:Abcc6 UTSW 7 46016396 missense probably benign 0.00
R9127:Abcc6 UTSW 7 45979760 missense probably damaging 1.00
R9480:Abcc6 UTSW 7 45979773 missense probably damaging 1.00
R9535:Abcc6 UTSW 7 45977263 missense probably damaging 1.00
X0065:Abcc6 UTSW 7 46020197 missense probably damaging 0.99
Z1176:Abcc6 UTSW 7 45979734 missense probably damaging 1.00
Z1176:Abcc6 UTSW 7 45992306 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TAGAGGCCAGCTGATGAGTG -3'
(R):5'- TCTTTTAAAAGTACCTGGGTTCCC -3'

Sequencing Primer
(F):5'- CCAGCTGATGAGTGCTCTAGAG -3'
(R):5'- CCCAGGGGTGGCTACTG -3'
Posted On 2022-06-15