Mutagenetix > Incidental Mutation

Incidental Mutation 'R9475:Ntrk3'

715706

Institutional Source

Beutler Lab

Gene Symbol

Ntrk3

Ensembl Gene

ENSMUSG00000059146

Gene Name

neurotrophic tyrosine kinase, receptor, type 3

Synonyms

TrkC

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9475 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

78175959-78738012 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 78302732 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Arginine at position 579 (M579R)

Ref Sequence

ENSEMBL: ENSMUSP00000038324 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039431] [ENSMUST00000039438] [ENSMUST00000193002] [ENSMUST00000195262]

AlphaFold

Q6VNS1

Predicted Effect

probably benign
Transcript: ENSMUST00000039431

SMART Domains

Protein: ENSMUSP00000037909
Gene: ENSMUSG00000059146

Domain	Start	End	E-Value	Type
LRRNT	31	63	2.46e-4	SMART
LRRCT	160	208	3.58e-12	SMART
IG	216	302	1.24e-8	SMART
Pfam:I-set	308	392	2.4e-8	PFAM
transmembrane domain	430	452	N/A	INTRINSIC
TyrKc	538	810	1.49e-145	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000039438
AA Change: M579R

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000038324
Gene: ENSMUSG00000059146
AA Change: M579R

Domain	Start	End	E-Value	Type
LRRNT	31	63	2.46e-4	SMART
LRRCT	160	208	3.58e-12	SMART
IG	216	302	1.24e-8	SMART
Pfam:I-set	308	392	3.1e-8	PFAM
transmembrane domain	429	451	N/A	INTRINSIC
PDB:2MFQ\|B	497	517	2e-6	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000193002

SMART Domains

Protein: ENSMUSP00000141534
Gene: ENSMUSG00000059146

Domain	Start	End	E-Value	Type
LRRNT	31	63	2.46e-4	SMART
LRRCT	160	208	3.58e-12	SMART
IG	216	302	1.24e-8	SMART
Pfam:I-set	308	392	2.4e-8	PFAM
Pfam:Ig_2	312	392	6.9e-4	PFAM
transmembrane domain	430	452	N/A	INTRINSIC
TyrKc	538	824	4.29e-137	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000195262

SMART Domains

Protein: ENSMUSP00000141599
Gene: ENSMUSG00000059146

Domain	Start	End	E-Value	Type
LRRNT	31	63	1.2e-6	SMART
LRRCT	160	208	1.8e-14	SMART
IG	216	302	5.1e-11	SMART
Pfam:I-set	308	392	4.7e-7	PFAM
Pfam:Ig_2	312	392	1.3e-2	PFAM
transmembrane domain	430	452	N/A	INTRINSIC
TyrKc	538	849	9.7e-132	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000206599

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurotrophic tyrosine receptor kinase (NTRK) family. This kinase is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Signalling through this kinase leads to cell differentiation and may play a role in the development of proprioceptive neurons that sense body position. Mutations in this gene have been associated with medulloblastomas, secretory breast carcinomas and other cancers. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygotes for targeted mutations show a range of phenotypes including postnatal death at 2-21 days, cardiac defects, reduced numbers of dorsal root ganglia neurons and germ cells, abnormal motor coordination and posture and abnormal sensory innervation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc6	A	T	7: 46,016,468	W243R	probably damaging	Het
Ablim1	T	G	19: 57,239,180	K18Q	probably benign	Het
Adamts18	T	A	8: 113,777,938	N174Y	possibly damaging	Het
Agbl2	A	G	2: 90,784,093	H23R	probably benign	Het
Akap6	T	G	12: 53,010,552	Y934D	probably damaging	Het
Alas1	C	T	9: 106,234,062	S635N	probably benign	Het
Ankrd24	A	G	10: 81,642,299		probably null	Het
Atp6v0a4	A	G	6: 38,060,982	L560P	probably damaging	Het
Cacng1	C	T	11: 107,716,292	V34M	possibly damaging	Het
Clcn3	C	T	8: 60,934,517	A233T	probably damaging	Het
Cntnap3	A	G	13: 64,799,135	F160S	probably damaging	Het
Ctnnd2	A	G	15: 30,881,130	S719G	probably damaging	Het
Exosc2	G	A	2: 31,674,743	V107I	probably benign	Het
Fam83b	C	A	9: 76,491,803	V673F	probably benign	Het
Fras1	T	C	5: 96,780,070	F3781L	probably damaging	Het
Gal3st1	T	A	11: 3,998,660	L289H	probably damaging	Het
Garem1	T	C	18: 21,148,313	I329V	probably benign	Het
Gli3	G	A	13: 15,725,711	G1228S	possibly damaging	Het
Gpbp1l1	T	C	4: 116,574,361	F72S	possibly damaging	Het
Hao1	T	A	2: 134,548,261	M53L	probably benign	Het
Hjurp	CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT	C	1: 88,266,277		probably benign	Het
Iqcm	A	G	8: 75,753,455	E347G	probably damaging	Het
Itpr3	G	A	17: 27,118,677		probably benign	Het
Kcnrg	A	G	14: 61,607,657	I49V	possibly damaging	Het
Lrrc8e	G	A	8: 4,235,346	G524S	probably benign	Het
Lrrn1	A	T	6: 107,568,300	Y353F	probably damaging	Het
Mdn1	A	G	4: 32,739,849	D3701G	possibly damaging	Het
Mtmr2	A	G	9: 13,805,471	T623A	probably benign	Het
Ndst4	C	A	3: 125,714,647	S287*	probably null	Het
Oas1a	G	A	5: 120,899,254	L237F	probably damaging	Het
Olfr1350	A	T	7: 6,570,819	Y276F	probably damaging	Het
Olfr169	T	C	16: 19,566,520	D121G	probably benign	Het
Olfr857	T	C	9: 19,713,643	M272T	probably benign	Het
Paqr5	T	A	9: 61,956,225	I272F	probably damaging	Het
Pcdha11	T	A	18: 37,007,538	V740E	probably damaging	Het
Pdgfra	A	C	5: 75,167,927	N240T	possibly damaging	Het
Plbd2	G	A	5: 120,494,380	Q186*	probably null	Het
Plce1	G	A	19: 38,777,893	E2121K	possibly damaging	Het
Ppargc1a	C	A	5: 51,495,738	G161C	probably damaging	Het
Ptprk	T	C	10: 28,334,480	I166T	possibly damaging	Het
Rhox8	GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT	GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT	X: 37,878,114		probably benign	Het
Rpap2	T	A	5: 107,620,589	L431Q	probably damaging	Het
Rslcan18	T	A	13: 67,102,064	K160*	probably null	Het
Sema7a	T	C	9: 57,954,905	F180L	probably benign	Het
Sh2d3c	C	T	2: 32,753,027	L741F	probably damaging	Het
Shank1	G	A	7: 44,312,918	S71N	unknown	Het
Skint6	C	T	4: 112,806,840		probably null	Het
Skiv2l	A	T	17: 34,841,102	D897E	probably benign	Het
Slc35f3	T	C	8: 126,382,254	S181P	probably damaging	Het
Slc4a9	A	T	18: 36,529,216	E127V	probably null	Het
Spata5	T	C	3: 37,431,909	V260A	probably benign	Het
Speg	C	T	1: 75,388,091	T372I	probably damaging	Het
Syce1l	A	G	8: 113,655,103	T204A	probably benign	Het
Tas2r138	T	A	6: 40,612,458	M285L	probably benign	Het
Tbc1d10a	G	C	11: 4,213,604	K285N	probably damaging	Het
Trim9	T	A	12: 70,346,454	M239L	probably benign	Het
Trp53bp1	A	G	2: 121,209,280	S1293P	probably benign	Het
Uaca	C	T	9: 60,872,216	T1295M	possibly damaging	Het
Ubald1	G	T	16: 4,875,569	Q161K	possibly damaging	Het
Ugt1a10	C	T	1: 88,216,260	R201C	probably damaging	Het
Vps45	T	G	3: 96,042,925	T231P	probably damaging	Het
Wdr17	A	T	8: 54,635,477	D1186E	probably benign	Het
Zfp534	G	A	4: 147,682,274	T8I	probably benign	Het
Zfp68	T	C	5: 138,607,255	N269D	probably benign	Het

Other mutations in Ntrk3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00424:Ntrk3	APN	7	78250873	missense	probably benign	0.03
IGL00862:Ntrk3	APN	7	78247177	missense	probably damaging	1.00
IGL00972:Ntrk3	APN	7	78247322	missense	possibly damaging	0.95
IGL00976:Ntrk3	APN	7	78450953	missense	probably benign	0.02
IGL02172:Ntrk3	APN	7	78460272	splice site	probably benign
IGL02175:Ntrk3	APN	7	78247228	missense	probably damaging	1.00
IGL02213:Ntrk3	APN	7	78462931	missense	probably benign	0.17
IGL02363:Ntrk3	APN	7	78453337	missense	probably benign	0.24
IGL02527:Ntrk3	APN	7	78451949	missense	probably benign
IGL02673:Ntrk3	APN	7	78250764	missense	probably damaging	1.00
IGL02755:Ntrk3	APN	7	78460439	missense	probably benign
IGL02998:Ntrk3	APN	7	78577657	missense	probably damaging	0.98
IGL03235:Ntrk3	APN	7	78192592	missense	probably damaging	1.00
R1465:Ntrk3	UTSW	7	78356014	splice site	probably benign
R1505:Ntrk3	UTSW	7	78460524	missense	probably damaging	0.99
R1638:Ntrk3	UTSW	7	78247288	missense	probably damaging	1.00
R1641:Ntrk3	UTSW	7	78356074	missense	probably damaging	1.00
R1775:Ntrk3	UTSW	7	78356041	missense	possibly damaging	0.60
R1786:Ntrk3	UTSW	7	78477935	splice site	probably benign
R1827:Ntrk3	UTSW	7	78247301	missense	probably damaging	1.00
R1868:Ntrk3	UTSW	7	78192604	missense	possibly damaging	0.90
R1873:Ntrk3	UTSW	7	78462839	missense	probably benign
R1929:Ntrk3	UTSW	7	78516723	splice site	probably null
R1941:Ntrk3	UTSW	7	78247262	missense	probably damaging	1.00
R2132:Ntrk3	UTSW	7	78477935	splice site	probably benign
R2214:Ntrk3	UTSW	7	78516772	missense	probably damaging	1.00
R2221:Ntrk3	UTSW	7	78198852	missense	probably damaging	1.00
R2223:Ntrk3	UTSW	7	78198852	missense	probably damaging	1.00
R2271:Ntrk3	UTSW	7	78516723	splice site	probably null
R2441:Ntrk3	UTSW	7	78302662	missense	probably damaging	1.00
R3108:Ntrk3	UTSW	7	78460515	missense	probably benign	0.01
R3109:Ntrk3	UTSW	7	78460515	missense	probably benign	0.01
R3959:Ntrk3	UTSW	7	78198842	missense	probably damaging	1.00
R4016:Ntrk3	UTSW	7	78462947	splice site	probably benign
R4028:Ntrk3	UTSW	7	78192710	missense	probably damaging	1.00
R4067:Ntrk3	UTSW	7	78517437	missense	probably damaging	1.00
R4398:Ntrk3	UTSW	7	78250769	nonsense	probably null
R4664:Ntrk3	UTSW	7	78461099	missense	probably damaging	0.99
R5045:Ntrk3	UTSW	7	78460424	missense	probably benign	0.13
R5081:Ntrk3	UTSW	7	78577774	missense	probably damaging	0.99
R5151:Ntrk3	UTSW	7	78247300	missense	probably damaging	1.00
R5249:Ntrk3	UTSW	7	78461166	missense	possibly damaging	0.87
R5294:Ntrk3	UTSW	7	78517506	splice site	probably null
R5594:Ntrk3	UTSW	7	78451899	missense	probably benign	0.10
R5923:Ntrk3	UTSW	7	78451928	missense	possibly damaging	0.61
R6878:Ntrk3	UTSW	7	78304372	missense	probably benign	0.00
R7083:Ntrk3	UTSW	7	78250839	missense	probably damaging	1.00
R7178:Ntrk3	UTSW	7	78356147	missense	possibly damaging	0.86
R7487:Ntrk3	UTSW	7	78250713	missense	probably damaging	1.00
R7607:Ntrk3	UTSW	7	78250873	missense	probably benign	0.03
R7800:Ntrk3	UTSW	7	78302740	missense	probably benign	0.09
R7961:Ntrk3	UTSW	7	78453328	missense	probably benign
R7976:Ntrk3	UTSW	7	78356206	missense	probably damaging	0.97
R8009:Ntrk3	UTSW	7	78453328	missense	probably benign
R8032:Ntrk3	UTSW	7	78356059	missense	probably damaging	1.00
R8104:Ntrk3	UTSW	7	78577702	missense	probably damaging	0.99
R8230:Ntrk3	UTSW	7	78250770	missense	probably damaging	1.00
R8254:Ntrk3	UTSW	7	78192578	missense	probably damaging	1.00
R8412:Ntrk3	UTSW	7	78356149	missense	probably benign	0.02
R8465:Ntrk3	UTSW	7	78462883	missense	probably damaging	0.99
R8841:Ntrk3	UTSW	7	78356093	missense	probably damaging	0.99
R9187:Ntrk3	UTSW	7	78247218	missense	possibly damaging	0.93
R9444:Ntrk3	UTSW	7	78461057	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAGCGCTTCCAACCTCTCAG -3'
(R):5'- CCCAGCAAAATGGAGTGTTTTC -3'

Sequencing Primer
(F):5'- TCTCAGAGGGCCCATCCTAC -3'
(R):5'- GGAGTGTTTTCCATTTCTCTGAGCAC -3'

Posted On

2022-06-15