Incidental Mutation 'R9475:Ntrk3'
ID 715706
Institutional Source Beutler Lab
Gene Symbol Ntrk3
Ensembl Gene ENSMUSG00000059146
Gene Name neurotrophic tyrosine kinase, receptor, type 3
Synonyms TrkC
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9475 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 77825711-78228865 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 77952480 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Arginine at position 579 (M579R)
Ref Sequence ENSEMBL: ENSMUSP00000038324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039431] [ENSMUST00000039438] [ENSMUST00000193002] [ENSMUST00000195262]
AlphaFold Q6VNS1
Predicted Effect probably benign
Transcript: ENSMUST00000039431
SMART Domains Protein: ENSMUSP00000037909
Gene: ENSMUSG00000059146

DomainStartEndE-ValueType
LRRNT 31 63 2.46e-4 SMART
LRRCT 160 208 3.58e-12 SMART
IG 216 302 1.24e-8 SMART
Pfam:I-set 308 392 2.4e-8 PFAM
transmembrane domain 430 452 N/A INTRINSIC
TyrKc 538 810 1.49e-145 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000039438
AA Change: M579R

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000038324
Gene: ENSMUSG00000059146
AA Change: M579R

DomainStartEndE-ValueType
LRRNT 31 63 2.46e-4 SMART
LRRCT 160 208 3.58e-12 SMART
IG 216 302 1.24e-8 SMART
Pfam:I-set 308 392 3.1e-8 PFAM
transmembrane domain 429 451 N/A INTRINSIC
PDB:2MFQ|B 497 517 2e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000193002
SMART Domains Protein: ENSMUSP00000141534
Gene: ENSMUSG00000059146

DomainStartEndE-ValueType
LRRNT 31 63 2.46e-4 SMART
LRRCT 160 208 3.58e-12 SMART
IG 216 302 1.24e-8 SMART
Pfam:I-set 308 392 2.4e-8 PFAM
Pfam:Ig_2 312 392 6.9e-4 PFAM
transmembrane domain 430 452 N/A INTRINSIC
TyrKc 538 824 4.29e-137 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195262
SMART Domains Protein: ENSMUSP00000141599
Gene: ENSMUSG00000059146

DomainStartEndE-ValueType
LRRNT 31 63 1.2e-6 SMART
LRRCT 160 208 1.8e-14 SMART
IG 216 302 5.1e-11 SMART
Pfam:I-set 308 392 4.7e-7 PFAM
Pfam:Ig_2 312 392 1.3e-2 PFAM
transmembrane domain 430 452 N/A INTRINSIC
TyrKc 538 849 9.7e-132 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206599
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurotrophic tyrosine receptor kinase (NTRK) family. This kinase is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Signalling through this kinase leads to cell differentiation and may play a role in the development of proprioceptive neurons that sense body position. Mutations in this gene have been associated with medulloblastomas, secretory breast carcinomas and other cancers. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygotes for targeted mutations show a range of phenotypes including postnatal death at 2-21 days, cardiac defects, reduced numbers of dorsal root ganglia neurons and germ cells, abnormal motor coordination and posture and abnormal sensory innervation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A T 7: 45,665,892 (GRCm39) W243R probably damaging Het
Ablim1 T G 19: 57,227,612 (GRCm39) K18Q probably benign Het
Adamts18 T A 8: 114,504,570 (GRCm39) N174Y possibly damaging Het
Afg2a T C 3: 37,486,058 (GRCm39) V260A probably benign Het
Agbl2 A G 2: 90,614,437 (GRCm39) H23R probably benign Het
Akap6 T G 12: 53,057,335 (GRCm39) Y934D probably damaging Het
Alas1 C T 9: 106,111,261 (GRCm39) S635N probably benign Het
Ankrd24 A G 10: 81,478,133 (GRCm39) probably null Het
Atp6v0a4 A G 6: 38,037,917 (GRCm39) L560P probably damaging Het
Cacng1 C T 11: 107,607,118 (GRCm39) V34M possibly damaging Het
Clcn3 C T 8: 61,387,551 (GRCm39) A233T probably damaging Het
Cntnap3 A G 13: 64,946,949 (GRCm39) F160S probably damaging Het
Ctnnd2 A G 15: 30,881,276 (GRCm39) S719G probably damaging Het
Exosc2 G A 2: 31,564,755 (GRCm39) V107I probably benign Het
Fam83b C A 9: 76,399,085 (GRCm39) V673F probably benign Het
Fras1 T C 5: 96,927,929 (GRCm39) F3781L probably damaging Het
Gal3st1 T A 11: 3,948,660 (GRCm39) L289H probably damaging Het
Garem1 T C 18: 21,281,370 (GRCm39) I329V probably benign Het
Gli3 G A 13: 15,900,296 (GRCm39) G1228S possibly damaging Het
Gpbp1l1 T C 4: 116,431,558 (GRCm39) F72S possibly damaging Het
Hao1 T A 2: 134,390,181 (GRCm39) M53L probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,193,999 (GRCm39) probably benign Het
Iqcm A G 8: 76,480,083 (GRCm39) E347G probably damaging Het
Itpr3 G A 17: 27,337,651 (GRCm39) probably benign Het
Kcnrg A G 14: 61,845,106 (GRCm39) I49V possibly damaging Het
Lrrc8e G A 8: 4,285,346 (GRCm39) G524S probably benign Het
Lrrn1 A T 6: 107,545,261 (GRCm39) Y353F probably damaging Het
Mdn1 A G 4: 32,739,849 (GRCm39) D3701G possibly damaging Het
Mtmr2 A G 9: 13,716,767 (GRCm39) T623A probably benign Het
Ndst4 C A 3: 125,508,296 (GRCm39) S287* probably null Het
Oas1a G A 5: 121,037,317 (GRCm39) L237F probably damaging Het
Or2aj4 T C 16: 19,385,270 (GRCm39) D121G probably benign Het
Or5bw2 A T 7: 6,573,818 (GRCm39) Y276F probably damaging Het
Or7e166 T C 9: 19,624,939 (GRCm39) M272T probably benign Het
Paqr5 T A 9: 61,863,507 (GRCm39) I272F probably damaging Het
Pcdha11 T A 18: 37,140,591 (GRCm39) V740E probably damaging Het
Pdgfra A C 5: 75,328,588 (GRCm39) N240T possibly damaging Het
Plbd2 G A 5: 120,632,445 (GRCm39) Q186* probably null Het
Plce1 G A 19: 38,766,337 (GRCm39) E2121K possibly damaging Het
Ppargc1a C A 5: 51,653,080 (GRCm39) G161C probably damaging Het
Ptprk T C 10: 28,210,476 (GRCm39) I166T possibly damaging Het
Rhox8 GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT X: 36,966,991 (GRCm39) probably benign Het
Rpap2 T A 5: 107,768,455 (GRCm39) L431Q probably damaging Het
Rslcan18 T A 13: 67,250,128 (GRCm39) K160* probably null Het
Sema7a T C 9: 57,862,188 (GRCm39) F180L probably benign Het
Sh2d3c C T 2: 32,643,039 (GRCm39) L741F probably damaging Het
Shank1 G A 7: 43,962,342 (GRCm39) S71N unknown Het
Skic2 A T 17: 35,060,078 (GRCm39) D897E probably benign Het
Skint6 C T 4: 112,664,037 (GRCm39) probably null Het
Slc35f3 T C 8: 127,108,993 (GRCm39) S181P probably damaging Het
Slc4a9 A T 18: 36,662,269 (GRCm39) E127V probably null Het
Speg C T 1: 75,364,735 (GRCm39) T372I probably damaging Het
Syce1l A G 8: 114,381,735 (GRCm39) T204A probably benign Het
Tas2r138 T A 6: 40,589,392 (GRCm39) M285L probably benign Het
Tbc1d10a G C 11: 4,163,604 (GRCm39) K285N probably damaging Het
Trim9 T A 12: 70,393,228 (GRCm39) M239L probably benign Het
Trp53bp1 A G 2: 121,039,761 (GRCm39) S1293P probably benign Het
Uaca C T 9: 60,779,498 (GRCm39) T1295M possibly damaging Het
Ubald1 G T 16: 4,693,433 (GRCm39) Q161K possibly damaging Het
Ugt1a10 C T 1: 88,143,982 (GRCm39) R201C probably damaging Het
Vps45 T G 3: 95,950,237 (GRCm39) T231P probably damaging Het
Wdr17 A T 8: 55,088,512 (GRCm39) D1186E probably benign Het
Zfp534 G A 4: 147,766,731 (GRCm39) T8I probably benign Het
Zfp68 T C 5: 138,605,517 (GRCm39) N269D probably benign Het
Other mutations in Ntrk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Ntrk3 APN 7 77,900,621 (GRCm39) missense probably benign 0.03
IGL00862:Ntrk3 APN 7 77,896,925 (GRCm39) missense probably damaging 1.00
IGL00972:Ntrk3 APN 7 77,897,070 (GRCm39) missense possibly damaging 0.95
IGL00976:Ntrk3 APN 7 78,100,701 (GRCm39) missense probably benign 0.02
IGL02172:Ntrk3 APN 7 78,110,020 (GRCm39) splice site probably benign
IGL02175:Ntrk3 APN 7 77,896,976 (GRCm39) missense probably damaging 1.00
IGL02213:Ntrk3 APN 7 78,112,679 (GRCm39) missense probably benign 0.17
IGL02363:Ntrk3 APN 7 78,103,085 (GRCm39) missense probably benign 0.24
IGL02527:Ntrk3 APN 7 78,101,697 (GRCm39) missense probably benign
IGL02673:Ntrk3 APN 7 77,900,512 (GRCm39) missense probably damaging 1.00
IGL02755:Ntrk3 APN 7 78,110,187 (GRCm39) missense probably benign
IGL02998:Ntrk3 APN 7 78,227,405 (GRCm39) missense probably damaging 0.98
IGL03235:Ntrk3 APN 7 77,842,340 (GRCm39) missense probably damaging 1.00
R1465:Ntrk3 UTSW 7 78,005,762 (GRCm39) splice site probably benign
R1505:Ntrk3 UTSW 7 78,110,272 (GRCm39) missense probably damaging 0.99
R1638:Ntrk3 UTSW 7 77,897,036 (GRCm39) missense probably damaging 1.00
R1641:Ntrk3 UTSW 7 78,005,822 (GRCm39) missense probably damaging 1.00
R1775:Ntrk3 UTSW 7 78,005,789 (GRCm39) missense possibly damaging 0.60
R1786:Ntrk3 UTSW 7 78,127,683 (GRCm39) splice site probably benign
R1827:Ntrk3 UTSW 7 77,897,049 (GRCm39) missense probably damaging 1.00
R1868:Ntrk3 UTSW 7 77,842,352 (GRCm39) missense possibly damaging 0.90
R1873:Ntrk3 UTSW 7 78,112,587 (GRCm39) missense probably benign
R1929:Ntrk3 UTSW 7 78,166,471 (GRCm39) splice site probably null
R1941:Ntrk3 UTSW 7 77,897,010 (GRCm39) missense probably damaging 1.00
R2132:Ntrk3 UTSW 7 78,127,683 (GRCm39) splice site probably benign
R2214:Ntrk3 UTSW 7 78,166,520 (GRCm39) missense probably damaging 1.00
R2221:Ntrk3 UTSW 7 77,848,600 (GRCm39) missense probably damaging 1.00
R2223:Ntrk3 UTSW 7 77,848,600 (GRCm39) missense probably damaging 1.00
R2271:Ntrk3 UTSW 7 78,166,471 (GRCm39) splice site probably null
R2441:Ntrk3 UTSW 7 77,952,410 (GRCm39) missense probably damaging 1.00
R3108:Ntrk3 UTSW 7 78,110,263 (GRCm39) missense probably benign 0.01
R3109:Ntrk3 UTSW 7 78,110,263 (GRCm39) missense probably benign 0.01
R3959:Ntrk3 UTSW 7 77,848,590 (GRCm39) missense probably damaging 1.00
R4016:Ntrk3 UTSW 7 78,112,695 (GRCm39) splice site probably benign
R4028:Ntrk3 UTSW 7 77,842,458 (GRCm39) missense probably damaging 1.00
R4067:Ntrk3 UTSW 7 78,167,185 (GRCm39) missense probably damaging 1.00
R4398:Ntrk3 UTSW 7 77,900,517 (GRCm39) nonsense probably null
R4664:Ntrk3 UTSW 7 78,110,847 (GRCm39) missense probably damaging 0.99
R5045:Ntrk3 UTSW 7 78,110,172 (GRCm39) missense probably benign 0.13
R5081:Ntrk3 UTSW 7 78,227,522 (GRCm39) missense probably damaging 0.99
R5151:Ntrk3 UTSW 7 77,897,048 (GRCm39) missense probably damaging 1.00
R5249:Ntrk3 UTSW 7 78,110,914 (GRCm39) missense possibly damaging 0.87
R5294:Ntrk3 UTSW 7 78,167,254 (GRCm39) splice site probably null
R5594:Ntrk3 UTSW 7 78,101,647 (GRCm39) missense probably benign 0.10
R5923:Ntrk3 UTSW 7 78,101,676 (GRCm39) missense possibly damaging 0.61
R6878:Ntrk3 UTSW 7 77,954,120 (GRCm39) missense probably benign 0.00
R7083:Ntrk3 UTSW 7 77,900,587 (GRCm39) missense probably damaging 1.00
R7178:Ntrk3 UTSW 7 78,005,895 (GRCm39) missense possibly damaging 0.86
R7487:Ntrk3 UTSW 7 77,900,461 (GRCm39) missense probably damaging 1.00
R7607:Ntrk3 UTSW 7 77,900,621 (GRCm39) missense probably benign 0.03
R7800:Ntrk3 UTSW 7 77,952,488 (GRCm39) missense probably benign 0.09
R7961:Ntrk3 UTSW 7 78,103,076 (GRCm39) missense probably benign
R7976:Ntrk3 UTSW 7 78,005,954 (GRCm39) missense probably damaging 0.97
R8009:Ntrk3 UTSW 7 78,103,076 (GRCm39) missense probably benign
R8032:Ntrk3 UTSW 7 78,005,807 (GRCm39) missense probably damaging 1.00
R8104:Ntrk3 UTSW 7 78,227,450 (GRCm39) missense probably damaging 0.99
R8230:Ntrk3 UTSW 7 77,900,518 (GRCm39) missense probably damaging 1.00
R8254:Ntrk3 UTSW 7 77,842,326 (GRCm39) missense probably damaging 1.00
R8412:Ntrk3 UTSW 7 78,005,897 (GRCm39) missense probably benign 0.02
R8465:Ntrk3 UTSW 7 78,112,631 (GRCm39) missense probably damaging 0.99
R8841:Ntrk3 UTSW 7 78,005,841 (GRCm39) missense probably damaging 0.99
R9187:Ntrk3 UTSW 7 77,896,966 (GRCm39) missense possibly damaging 0.93
R9444:Ntrk3 UTSW 7 78,110,805 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCGCTTCCAACCTCTCAG -3'
(R):5'- CCCAGCAAAATGGAGTGTTTTC -3'

Sequencing Primer
(F):5'- TCTCAGAGGGCCCATCCTAC -3'
(R):5'- GGAGTGTTTTCCATTTCTCTGAGCAC -3'
Posted On 2022-06-15