Incidental Mutation 'R9475:Uaca'
ID 715717
Institutional Source Beutler Lab
Gene Symbol Uaca
Ensembl Gene ENSMUSG00000034485
Gene Name uveal autoantigen with coiled-coil domains and ankyrin repeats
Synonyms nucling, 2700059D02Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.173) question?
Stock # R9475 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 60701824-60787652 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 60779498 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 1295 (T1295M)
Ref Sequence ENSEMBL: ENSMUSP00000062047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050183] [ENSMUST00000214354]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000050183
AA Change: T1295M

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000062047
Gene: ENSMUSG00000034485
AA Change: T1295M

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
ANK 35 68 2.66e3 SMART
ANK 69 98 1.96e-3 SMART
ANK 102 131 1.65e-1 SMART
ANK 135 164 1.38e-3 SMART
ANK 168 197 3.65e-3 SMART
ANK 201 230 6.26e-2 SMART
Blast:ANK 234 263 7e-9 BLAST
coiled coil region 301 381 N/A INTRINSIC
coiled coil region 445 626 N/A INTRINSIC
Pfam:TolA_bind_tri 869 943 4e-11 PFAM
coiled coil region 1009 1382 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000214354
AA Change: T1293M

PolyPhen 2 Score 0.722 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice display swelling of and inflammatory lesions in the preputial gland. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A T 7: 45,665,892 (GRCm39) W243R probably damaging Het
Ablim1 T G 19: 57,227,612 (GRCm39) K18Q probably benign Het
Adamts18 T A 8: 114,504,570 (GRCm39) N174Y possibly damaging Het
Afg2a T C 3: 37,486,058 (GRCm39) V260A probably benign Het
Agbl2 A G 2: 90,614,437 (GRCm39) H23R probably benign Het
Akap6 T G 12: 53,057,335 (GRCm39) Y934D probably damaging Het
Alas1 C T 9: 106,111,261 (GRCm39) S635N probably benign Het
Ankrd24 A G 10: 81,478,133 (GRCm39) probably null Het
Atp6v0a4 A G 6: 38,037,917 (GRCm39) L560P probably damaging Het
Cacng1 C T 11: 107,607,118 (GRCm39) V34M possibly damaging Het
Clcn3 C T 8: 61,387,551 (GRCm39) A233T probably damaging Het
Cntnap3 A G 13: 64,946,949 (GRCm39) F160S probably damaging Het
Ctnnd2 A G 15: 30,881,276 (GRCm39) S719G probably damaging Het
Exosc2 G A 2: 31,564,755 (GRCm39) V107I probably benign Het
Fam83b C A 9: 76,399,085 (GRCm39) V673F probably benign Het
Fras1 T C 5: 96,927,929 (GRCm39) F3781L probably damaging Het
Gal3st1 T A 11: 3,948,660 (GRCm39) L289H probably damaging Het
Garem1 T C 18: 21,281,370 (GRCm39) I329V probably benign Het
Gli3 G A 13: 15,900,296 (GRCm39) G1228S possibly damaging Het
Gpbp1l1 T C 4: 116,431,558 (GRCm39) F72S possibly damaging Het
Hao1 T A 2: 134,390,181 (GRCm39) M53L probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,193,999 (GRCm39) probably benign Het
Iqcm A G 8: 76,480,083 (GRCm39) E347G probably damaging Het
Itpr3 G A 17: 27,337,651 (GRCm39) probably benign Het
Kcnrg A G 14: 61,845,106 (GRCm39) I49V possibly damaging Het
Lrrc8e G A 8: 4,285,346 (GRCm39) G524S probably benign Het
Lrrn1 A T 6: 107,545,261 (GRCm39) Y353F probably damaging Het
Mdn1 A G 4: 32,739,849 (GRCm39) D3701G possibly damaging Het
Mtmr2 A G 9: 13,716,767 (GRCm39) T623A probably benign Het
Ndst4 C A 3: 125,508,296 (GRCm39) S287* probably null Het
Ntrk3 A C 7: 77,952,480 (GRCm39) M579R probably benign Het
Oas1a G A 5: 121,037,317 (GRCm39) L237F probably damaging Het
Or2aj4 T C 16: 19,385,270 (GRCm39) D121G probably benign Het
Or5bw2 A T 7: 6,573,818 (GRCm39) Y276F probably damaging Het
Or7e166 T C 9: 19,624,939 (GRCm39) M272T probably benign Het
Paqr5 T A 9: 61,863,507 (GRCm39) I272F probably damaging Het
Pcdha11 T A 18: 37,140,591 (GRCm39) V740E probably damaging Het
Pdgfra A C 5: 75,328,588 (GRCm39) N240T possibly damaging Het
Plbd2 G A 5: 120,632,445 (GRCm39) Q186* probably null Het
Plce1 G A 19: 38,766,337 (GRCm39) E2121K possibly damaging Het
Ppargc1a C A 5: 51,653,080 (GRCm39) G161C probably damaging Het
Ptprk T C 10: 28,210,476 (GRCm39) I166T possibly damaging Het
Rhox8 GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT X: 36,966,991 (GRCm39) probably benign Het
Rpap2 T A 5: 107,768,455 (GRCm39) L431Q probably damaging Het
Rslcan18 T A 13: 67,250,128 (GRCm39) K160* probably null Het
Sema7a T C 9: 57,862,188 (GRCm39) F180L probably benign Het
Sh2d3c C T 2: 32,643,039 (GRCm39) L741F probably damaging Het
Shank1 G A 7: 43,962,342 (GRCm39) S71N unknown Het
Skic2 A T 17: 35,060,078 (GRCm39) D897E probably benign Het
Skint6 C T 4: 112,664,037 (GRCm39) probably null Het
Slc35f3 T C 8: 127,108,993 (GRCm39) S181P probably damaging Het
Slc4a9 A T 18: 36,662,269 (GRCm39) E127V probably null Het
Speg C T 1: 75,364,735 (GRCm39) T372I probably damaging Het
Syce1l A G 8: 114,381,735 (GRCm39) T204A probably benign Het
Tas2r138 T A 6: 40,589,392 (GRCm39) M285L probably benign Het
Tbc1d10a G C 11: 4,163,604 (GRCm39) K285N probably damaging Het
Trim9 T A 12: 70,393,228 (GRCm39) M239L probably benign Het
Trp53bp1 A G 2: 121,039,761 (GRCm39) S1293P probably benign Het
Ubald1 G T 16: 4,693,433 (GRCm39) Q161K possibly damaging Het
Ugt1a10 C T 1: 88,143,982 (GRCm39) R201C probably damaging Het
Vps45 T G 3: 95,950,237 (GRCm39) T231P probably damaging Het
Wdr17 A T 8: 55,088,512 (GRCm39) D1186E probably benign Het
Zfp534 G A 4: 147,766,731 (GRCm39) T8I probably benign Het
Zfp68 T C 5: 138,605,517 (GRCm39) N269D probably benign Het
Other mutations in Uaca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Uaca APN 9 60,779,507 (GRCm39) missense probably benign
IGL01751:Uaca APN 9 60,777,139 (GRCm39) missense probably damaging 1.00
IGL02868:Uaca APN 9 60,770,919 (GRCm39) missense probably damaging 1.00
IGL02977:Uaca APN 9 60,773,662 (GRCm39) missense probably benign 0.00
IGL03037:Uaca APN 9 60,748,147 (GRCm39) missense probably damaging 1.00
IGL03060:Uaca APN 9 60,777,148 (GRCm39) missense probably damaging 1.00
IGL03083:Uaca APN 9 60,770,945 (GRCm39) missense probably benign 0.28
IGL03266:Uaca APN 9 60,770,689 (GRCm39) missense probably damaging 1.00
IGL03346:Uaca APN 9 60,761,600 (GRCm39) missense probably damaging 1.00
Ixtapa UTSW 9 60,777,695 (GRCm39) missense probably damaging 0.99
oaxaca UTSW 9 60,778,733 (GRCm39) missense probably benign
R0408:Uaca UTSW 9 60,779,141 (GRCm39) missense possibly damaging 0.71
R0567:Uaca UTSW 9 60,778,663 (GRCm39) missense probably benign 0.01
R0598:Uaca UTSW 9 60,778,203 (GRCm39) nonsense probably null
R0603:Uaca UTSW 9 60,778,379 (GRCm39) missense possibly damaging 0.60
R0655:Uaca UTSW 9 60,779,311 (GRCm39) missense probably benign 0.03
R0707:Uaca UTSW 9 60,755,900 (GRCm39) splice site probably benign
R0791:Uaca UTSW 9 60,779,341 (GRCm39) missense possibly damaging 0.50
R1466:Uaca UTSW 9 60,761,603 (GRCm39) missense possibly damaging 0.88
R1466:Uaca UTSW 9 60,761,603 (GRCm39) missense possibly damaging 0.88
R1520:Uaca UTSW 9 60,778,663 (GRCm39) missense probably benign 0.30
R1673:Uaca UTSW 9 60,779,438 (GRCm39) missense probably damaging 1.00
R1894:Uaca UTSW 9 60,777,718 (GRCm39) missense possibly damaging 0.87
R1997:Uaca UTSW 9 60,777,623 (GRCm39) missense probably damaging 1.00
R2042:Uaca UTSW 9 60,777,173 (GRCm39) missense probably damaging 1.00
R2095:Uaca UTSW 9 60,748,125 (GRCm39) missense probably benign 0.00
R2148:Uaca UTSW 9 60,776,961 (GRCm39) missense probably damaging 1.00
R2384:Uaca UTSW 9 60,777,199 (GRCm39) missense probably damaging 1.00
R3110:Uaca UTSW 9 60,778,781 (GRCm39) missense probably damaging 1.00
R3112:Uaca UTSW 9 60,778,781 (GRCm39) missense probably damaging 1.00
R4001:Uaca UTSW 9 60,778,366 (GRCm39) missense probably benign 0.04
R4155:Uaca UTSW 9 60,779,035 (GRCm39) missense probably benign 0.02
R4156:Uaca UTSW 9 60,779,035 (GRCm39) missense probably benign 0.02
R4157:Uaca UTSW 9 60,779,035 (GRCm39) missense probably benign 0.02
R4410:Uaca UTSW 9 60,777,173 (GRCm39) missense probably damaging 1.00
R4674:Uaca UTSW 9 60,761,711 (GRCm39) missense possibly damaging 0.94
R4871:Uaca UTSW 9 60,753,283 (GRCm39) missense probably damaging 1.00
R5130:Uaca UTSW 9 60,787,510 (GRCm39) missense probably damaging 0.96
R5328:Uaca UTSW 9 60,777,814 (GRCm39) missense probably benign 0.44
R5358:Uaca UTSW 9 60,778,430 (GRCm39) missense probably benign
R5415:Uaca UTSW 9 60,777,421 (GRCm39) missense possibly damaging 0.65
R5437:Uaca UTSW 9 60,778,733 (GRCm39) missense probably benign
R5647:Uaca UTSW 9 60,779,380 (GRCm39) missense probably benign 0.28
R5710:Uaca UTSW 9 60,779,093 (GRCm39) missense probably damaging 1.00
R5920:Uaca UTSW 9 60,776,885 (GRCm39) missense probably benign 0.19
R5931:Uaca UTSW 9 60,779,294 (GRCm39) missense probably damaging 0.97
R5933:Uaca UTSW 9 60,748,238 (GRCm39) missense probably damaging 1.00
R5959:Uaca UTSW 9 60,778,052 (GRCm39) missense probably damaging 1.00
R6193:Uaca UTSW 9 60,777,326 (GRCm39) missense probably damaging 0.99
R6195:Uaca UTSW 9 60,777,326 (GRCm39) missense probably damaging 0.99
R6242:Uaca UTSW 9 60,777,326 (GRCm39) missense probably damaging 0.99
R6243:Uaca UTSW 9 60,777,326 (GRCm39) missense probably damaging 0.99
R6244:Uaca UTSW 9 60,777,326 (GRCm39) missense probably damaging 0.99
R6274:Uaca UTSW 9 60,757,573 (GRCm39) splice site probably null
R6670:Uaca UTSW 9 60,779,306 (GRCm39) missense probably benign 0.09
R6883:Uaca UTSW 9 60,777,173 (GRCm39) missense probably damaging 1.00
R7011:Uaca UTSW 9 60,777,650 (GRCm39) missense probably damaging 1.00
R7111:Uaca UTSW 9 60,779,120 (GRCm39) missense probably benign 0.06
R7146:Uaca UTSW 9 60,777,695 (GRCm39) missense probably damaging 0.99
R7424:Uaca UTSW 9 60,777,392 (GRCm39) missense probably damaging 1.00
R7485:Uaca UTSW 9 60,753,282 (GRCm39) missense probably damaging 1.00
R7510:Uaca UTSW 9 60,757,487 (GRCm39) splice site probably null
R7688:Uaca UTSW 9 60,781,409 (GRCm39) missense probably benign 0.11
R7724:Uaca UTSW 9 60,777,187 (GRCm39) missense probably benign 0.24
R7743:Uaca UTSW 9 60,783,677 (GRCm39) missense probably damaging 0.99
R8556:Uaca UTSW 9 60,777,923 (GRCm39) missense probably damaging 0.97
R8699:Uaca UTSW 9 60,778,347 (GRCm39) missense probably damaging 1.00
R8814:Uaca UTSW 9 60,773,680 (GRCm39) missense possibly damaging 0.82
R8828:Uaca UTSW 9 60,778,852 (GRCm39) missense probably benign 0.00
R9477:Uaca UTSW 9 60,778,108 (GRCm39) missense probably benign 0.33
R9509:Uaca UTSW 9 60,779,498 (GRCm39) missense possibly damaging 0.88
X0067:Uaca UTSW 9 60,766,431 (GRCm39) missense possibly damaging 0.69
Z1177:Uaca UTSW 9 60,781,405 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCGAAGTACAAAGCCACC -3'
(R):5'- TCACACACCTGAGGTCAAACTG -3'

Sequencing Primer
(F):5'- GTCGAAGTACAAAGCCACCAAGAAC -3'
(R):5'- CCTGAGGTCAAACTGGCAGG -3'
Posted On 2022-06-15