Mutagenetix > Incidental Mutation

Incidental Mutation 'R9475:Ptprk'

715721

Institutional Source

Beutler Lab

Gene Symbol

Ptprk

Ensembl Gene

ENSMUSG00000019889

Gene Name

protein tyrosine phosphatase, receptor type, K

Synonyms

RPTPkappa, PTPk

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9475 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

28074820-28597397 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 28334480 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 166 (I166T)

Ref Sequence

ENSEMBL: ENSMUSP00000151866 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166468] [ENSMUST00000218276] [ENSMUST00000218359]

AlphaFold

P35822

Predicted Effect

SMART Domains

Protein: ENSMUSP00000126279
Gene: ENSMUSG00000019889
AA Change: I166T

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
MAM	30	193	1.61e-73	SMART
IG	200	288	2.16e-8	SMART
FN3	290	373	1.48e-4	SMART
FN3	389	475	4.24e1	SMART
FN3	491	579	3.32e-7	SMART
transmembrane domain	753	774	N/A	INTRINSIC
PTPc	898	1161	3.56e-132	SMART
PTPc	1190	1455	2.68e-86	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000218276
AA Change: I166T

PolyPhen 2 Score 0.601 (Sensitivity: 0.87; Specificity: 0.91)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000218359
AA Change: I166T

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP was shown to mediate homophilic intercellular interaction, possibly through the interaction with beta- and gamma-catenin at adherens junctions. Expression of this gene was found to be stimulated by TGF-beta 1, which may be important for the inhibition of keratinocyte proliferation. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc6	A	T	7: 46,016,468	W243R	probably damaging	Het
Ablim1	T	G	19: 57,239,180	K18Q	probably benign	Het
Adamts18	T	A	8: 113,777,938	N174Y	possibly damaging	Het
Agbl2	A	G	2: 90,784,093	H23R	probably benign	Het
Akap6	T	G	12: 53,010,552	Y934D	probably damaging	Het
Alas1	C	T	9: 106,234,062	S635N	probably benign	Het
Ankrd24	A	G	10: 81,642,299		probably null	Het
Atp6v0a4	A	G	6: 38,060,982	L560P	probably damaging	Het
Cacng1	C	T	11: 107,716,292	V34M	possibly damaging	Het
Clcn3	C	T	8: 60,934,517	A233T	probably damaging	Het
Cntnap3	A	G	13: 64,799,135	F160S	probably damaging	Het
Ctnnd2	A	G	15: 30,881,130	S719G	probably damaging	Het
Exosc2	G	A	2: 31,674,743	V107I	probably benign	Het
Fam83b	C	A	9: 76,491,803	V673F	probably benign	Het
Fras1	T	C	5: 96,780,070	F3781L	probably damaging	Het
Gal3st1	T	A	11: 3,998,660	L289H	probably damaging	Het
Garem1	T	C	18: 21,148,313	I329V	probably benign	Het
Gli3	G	A	13: 15,725,711	G1228S	possibly damaging	Het
Gpbp1l1	T	C	4: 116,574,361	F72S	possibly damaging	Het
Hao1	T	A	2: 134,548,261	M53L	probably benign	Het
Hjurp	CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT	C	1: 88,266,277		probably benign	Het
Iqcm	A	G	8: 75,753,455	E347G	probably damaging	Het
Itpr3	G	A	17: 27,118,677		probably benign	Het
Kcnrg	A	G	14: 61,607,657	I49V	possibly damaging	Het
Lrrc8e	G	A	8: 4,235,346	G524S	probably benign	Het
Lrrn1	A	T	6: 107,568,300	Y353F	probably damaging	Het
Mdn1	A	G	4: 32,739,849	D3701G	possibly damaging	Het
Mtmr2	A	G	9: 13,805,471	T623A	probably benign	Het
Ndst4	C	A	3: 125,714,647	S287*	probably null	Het
Ntrk3	A	C	7: 78,302,732	M579R	probably benign	Het
Oas1a	G	A	5: 120,899,254	L237F	probably damaging	Het
Olfr1350	A	T	7: 6,570,819	Y276F	probably damaging	Het
Olfr169	T	C	16: 19,566,520	D121G	probably benign	Het
Olfr857	T	C	9: 19,713,643	M272T	probably benign	Het
Paqr5	T	A	9: 61,956,225	I272F	probably damaging	Het
Pcdha11	T	A	18: 37,007,538	V740E	probably damaging	Het
Pdgfra	A	C	5: 75,167,927	N240T	possibly damaging	Het
Plbd2	G	A	5: 120,494,380	Q186*	probably null	Het
Plce1	G	A	19: 38,777,893	E2121K	possibly damaging	Het
Ppargc1a	C	A	5: 51,495,738	G161C	probably damaging	Het
Rhox8	GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT	GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT	X: 37,878,114		probably benign	Het
Rpap2	T	A	5: 107,620,589	L431Q	probably damaging	Het
Rslcan18	T	A	13: 67,102,064	K160*	probably null	Het
Sema7a	T	C	9: 57,954,905	F180L	probably benign	Het
Sh2d3c	C	T	2: 32,753,027	L741F	probably damaging	Het
Shank1	G	A	7: 44,312,918	S71N	unknown	Het
Skint6	C	T	4: 112,806,840		probably null	Het
Skiv2l	A	T	17: 34,841,102	D897E	probably benign	Het
Slc35f3	T	C	8: 126,382,254	S181P	probably damaging	Het
Slc4a9	A	T	18: 36,529,216	E127V	probably null	Het
Spata5	T	C	3: 37,431,909	V260A	probably benign	Het
Speg	C	T	1: 75,388,091	T372I	probably damaging	Het
Syce1l	A	G	8: 113,655,103	T204A	probably benign	Het
Tas2r138	T	A	6: 40,612,458	M285L	probably benign	Het
Tbc1d10a	G	C	11: 4,213,604	K285N	probably damaging	Het
Trim9	T	A	12: 70,346,454	M239L	probably benign	Het
Trp53bp1	A	G	2: 121,209,280	S1293P	probably benign	Het
Uaca	C	T	9: 60,872,216	T1295M	possibly damaging	Het
Ubald1	G	T	16: 4,875,569	Q161K	possibly damaging	Het
Ugt1a10	C	T	1: 88,216,260	R201C	probably damaging	Het
Vps45	T	G	3: 96,042,925	T231P	probably damaging	Het
Wdr17	A	T	8: 54,635,477	D1186E	probably benign	Het
Zfp534	G	A	4: 147,682,274	T8I	probably benign	Het
Zfp68	T	C	5: 138,607,255	N269D	probably benign	Het

Other mutations in Ptprk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00310:Ptprk	APN	10	28336510	missense	possibly damaging	0.92
IGL00533:Ptprk	APN	10	28585975	missense	probably damaging	0.97
IGL01062:Ptprk	APN	10	28580418	missense	probably damaging	1.00
IGL01295:Ptprk	APN	10	28475178	missense	probably benign	0.14
IGL01372:Ptprk	APN	10	28569927	missense	probably benign	0.00
IGL01452:Ptprk	APN	10	28574917	critical splice donor site	probably null
IGL01829:Ptprk	APN	10	28573387	missense	probably damaging	1.00
IGL01861:Ptprk	APN	10	28383445	missense	possibly damaging	0.80
IGL01955:Ptprk	APN	10	28595865	unclassified	probably benign
IGL02263:Ptprk	APN	10	28075114	missense	unknown
IGL02489:Ptprk	APN	10	28383472	missense	probably damaging	1.00
IGL02697:Ptprk	APN	10	28575618	missense	possibly damaging	0.85
IGL02713:Ptprk	APN	10	28592811	missense	possibly damaging	0.92
IGL02943:Ptprk	APN	10	28475176	missense	possibly damaging	0.81
IGL03240:Ptprk	APN	10	28492961	missense	probably damaging	0.99
IGL03373:Ptprk	APN	10	28566537	missense	probably damaging	1.00
LCD18:Ptprk	UTSW	10	28574987	intron	probably benign
PIT4366001:Ptprk	UTSW	10	28586019	missense	probably benign
R0010:Ptprk	UTSW	10	28585969	missense	probably damaging	1.00
R0021:Ptprk	UTSW	10	28592895	missense	probably damaging	1.00
R0021:Ptprk	UTSW	10	28592895	missense	probably damaging	1.00
R0035:Ptprk	UTSW	10	28263508	nonsense	probably null
R0035:Ptprk	UTSW	10	28263508	nonsense	probably null
R0053:Ptprk	UTSW	10	28475109	missense	probably damaging	0.99
R0063:Ptprk	UTSW	10	28263767	missense	probably damaging	1.00
R0063:Ptprk	UTSW	10	28263767	missense	probably damaging	1.00
R0244:Ptprk	UTSW	10	28206225	missense	possibly damaging	0.79
R0281:Ptprk	UTSW	10	28573392	missense	probably damaging	1.00
R0387:Ptprk	UTSW	10	28354629	missense	possibly damaging	0.66
R0480:Ptprk	UTSW	10	28585947	missense	probably damaging	1.00
R0480:Ptprk	UTSW	10	28585948	missense	probably damaging	1.00
R0585:Ptprk	UTSW	10	28575668	missense	probably damaging	1.00
R0614:Ptprk	UTSW	10	28075136	missense	probably damaging	0.96
R0684:Ptprk	UTSW	10	28483298	splice site	probably benign
R1073:Ptprk	UTSW	10	28496947	critical splice donor site	probably null
R1377:Ptprk	UTSW	10	28586026	missense	probably benign	0.42
R1422:Ptprk	UTSW	10	28475280	missense	possibly damaging	0.64
R1482:Ptprk	UTSW	10	28263516	missense	probably benign	0.24
R1532:Ptprk	UTSW	10	28585630	missense	probably damaging	1.00
R1576:Ptprk	UTSW	10	28551651	missense	probably damaging	1.00
R1618:Ptprk	UTSW	10	28493170	missense	probably benign	0.00
R1654:Ptprk	UTSW	10	28383647	missense	probably damaging	1.00
R1701:Ptprk	UTSW	10	28466058	missense	probably damaging	1.00
R1747:Ptprk	UTSW	10	28354692	missense	possibly damaging	0.78
R2033:Ptprk	UTSW	10	28592767	unclassified	probably benign
R2059:Ptprk	UTSW	10	28566603	missense	probably damaging	1.00
R2076:Ptprk	UTSW	10	28589368	missense	probably damaging	0.98
R2164:Ptprk	UTSW	10	28560142	missense	probably damaging	1.00
R2260:Ptprk	UTSW	10	28206149	missense	possibly damaging	0.65
R2394:Ptprk	UTSW	10	28551717	missense	probably damaging	0.98
R2432:Ptprk	UTSW	10	28592844	missense	probably damaging	1.00
R2437:Ptprk	UTSW	10	28354713	missense	probably damaging	1.00
R2495:Ptprk	UTSW	10	28475078	splice site	probably benign
R3037:Ptprk	UTSW	10	28580478	missense	probably damaging	1.00
R3162:Ptprk	UTSW	10	28592826	missense	probably benign
R3162:Ptprk	UTSW	10	28592826	missense	probably benign
R3687:Ptprk	UTSW	10	28473043	missense	probably damaging	1.00
R3722:Ptprk	UTSW	10	28383623	missense	probably damaging	1.00
R3892:Ptprk	UTSW	10	28263621	missense	probably benign	0.02
R3963:Ptprk	UTSW	10	28551665	missense	probably damaging	0.99
R4077:Ptprk	UTSW	10	28263512	missense	probably benign
R4079:Ptprk	UTSW	10	28263512	missense	probably benign
R4112:Ptprk	UTSW	10	28475288	critical splice donor site	probably null
R4255:Ptprk	UTSW	10	28206245	missense	probably benign	0.14
R4523:Ptprk	UTSW	10	28466052	missense	probably damaging	0.99
R4651:Ptprk	UTSW	10	28263690	missense	probably damaging	0.99
R4652:Ptprk	UTSW	10	28263690	missense	probably damaging	0.99
R4828:Ptprk	UTSW	10	28560054	missense	probably damaging	1.00
R4829:Ptprk	UTSW	10	28580484	nonsense	probably null
R4883:Ptprk	UTSW	10	28588932	missense	probably damaging	1.00
R5004:Ptprk	UTSW	10	28586063	missense	possibly damaging	0.95
R5013:Ptprk	UTSW	10	28551717	missense	probably damaging	0.99
R5092:Ptprk	UTSW	10	28592773	missense	probably damaging	1.00
R5126:Ptprk	UTSW	10	28575644	splice site	probably null
R5183:Ptprk	UTSW	10	28475236	missense	probably benign	0.02
R5264:Ptprk	UTSW	10	28585586	missense	probably damaging	1.00
R5304:Ptprk	UTSW	10	28592054	splice site	probably null
R5330:Ptprk	UTSW	10	28587080	missense	probably damaging	1.00
R5474:Ptprk	UTSW	10	28496930	nonsense	probably null
R5516:Ptprk	UTSW	10	28496930	nonsense	probably null
R5796:Ptprk	UTSW	10	28383575	missense	probably damaging	1.00
R5843:Ptprk	UTSW	10	28493064	missense	probably damaging	0.99
R5952:Ptprk	UTSW	10	28585675	missense	probably damaging	0.99
R6065:Ptprk	UTSW	10	28475170	missense	probably damaging	1.00
R6226:Ptprk	UTSW	10	28564103	missense	probably benign	0.02
R6264:Ptprk	UTSW	10	28566673	missense	probably damaging	1.00
R6638:Ptprk	UTSW	10	28595811	missense	probably damaging	1.00
R6843:Ptprk	UTSW	10	28591982	missense	possibly damaging	0.86
R6860:Ptprk	UTSW	10	28334484	missense	probably damaging	1.00
R6869:Ptprk	UTSW	10	28473059	critical splice donor site	probably null
R7214:Ptprk	UTSW	10	28574909	missense	probably benign	0.11
R7307:Ptprk	UTSW	10	28589008	nonsense	probably null
R7349:Ptprk	UTSW	10	28592838	missense	possibly damaging	0.85
R7442:Ptprk	UTSW	10	28574819	missense	probably damaging	1.00
R7585:Ptprk	UTSW	10	28560088	missense	probably damaging	1.00
R7661:Ptprk	UTSW	10	28466040	missense	probably benign	0.00
R7694:Ptprk	UTSW	10	28589370	missense	possibly damaging	0.63
R7740:Ptprk	UTSW	10	28496924	missense	probably damaging	1.00
R7810:Ptprk	UTSW	10	28592857	missense	probably damaging	0.97
R7831:Ptprk	UTSW	10	28568408	missense	possibly damaging	0.89
R7836:Ptprk	UTSW	10	28573389	missense	probably damaging	1.00
R8049:Ptprk	UTSW	10	28383569	missense	possibly damaging	0.84
R8235:Ptprk	UTSW	10	28589041	missense	possibly damaging	0.70
R8274:Ptprk	UTSW	10	28580412	missense	probably damaging	1.00
R8286:Ptprk	UTSW	10	28568327	missense	probably damaging	1.00
R8372:Ptprk	UTSW	10	28354692	missense	possibly damaging	0.78
R8727:Ptprk	UTSW	10	28566545	unclassified	probably benign
R8794:Ptprk	UTSW	10	28263508	nonsense	probably null
R8842:Ptprk	UTSW	10	28566501	missense	probably damaging	0.97
R8861:Ptprk	UTSW	10	28570190	missense	probably damaging	1.00
R8897:Ptprk	UTSW	10	28591957	missense	probably damaging	1.00
R8910:Ptprk	UTSW	10	28492997	missense	possibly damaging	0.68
R8919:Ptprk	UTSW	10	28483207	nonsense	probably null
R8976:Ptprk	UTSW	10	28585673	missense	probably damaging	1.00
R8982:Ptprk	UTSW	10	28560142	missense	probably damaging	1.00
R9036:Ptprk	UTSW	10	28585932	missense	probably benign	0.01
R9135:Ptprk	UTSW	10	28580417	missense	probably damaging	1.00
R9308:Ptprk	UTSW	10	28574854	missense	probably benign	0.15
R9317:Ptprk	UTSW	10	28354735	missense	probably damaging	0.96
R9585:Ptprk	UTSW	10	28493151	nonsense	probably null
R9625:Ptprk	UTSW	10	28586010	missense	probably damaging	0.99
R9700:Ptprk	UTSW	10	28580499	missense	probably damaging	1.00
R9745:Ptprk	UTSW	10	28263612	missense	possibly damaging	0.46
Z1177:Ptprk	UTSW	10	28493120	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTTGCTAGTACGTGCTTAAGC -3'
(R):5'- ATGGCCAGGCAATAAACGATC -3'

Sequencing Primer
(F):5'- TTGGAACTTTGTGAACACAGCAG -3'
(R):5'- GATCAACAGCCTCTGCCAGTC -3'

Posted On

2022-06-15