Incidental Mutation 'R9475:Gal3st1'
ID 715723
Institutional Source Beutler Lab
Gene Symbol Gal3st1
Ensembl Gene ENSMUSG00000049721
Gene Name galactose-3-O-sulfotransferase 1
Synonyms galactosylceramide sulfotransferase, Gcst, Cst, 3'-phosphoadenylylsulfate-galactosylceramide 3'-sulfotransferase, GalCer sulfotransferase
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9475 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 3933636-3949326 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 3948660 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 289 (L289H)
Ref Sequence ENSEMBL: ENSMUSP00000058348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063004] [ENSMUST00000078757] [ENSMUST00000109981]
AlphaFold Q9JHE4
Predicted Effect probably damaging
Transcript: ENSMUST00000063004
AA Change: L289H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058348
Gene: ENSMUSG00000049721
AA Change: L289H

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 1 408 1.2e-184 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000078757
AA Change: L289H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077815
Gene: ENSMUSG00000049721
AA Change: L289H

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 1 408 1.2e-184 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109981
AA Change: L289H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105608
Gene: ENSMUSG00000049721
AA Change: L289H

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 1 408 1.2e-184 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfonation, an important step in the metabolism of many drugs, xenobiotics, hormones, and neurotransmitters, is catalyzed by sulfotransferases. This gene encodes galactosylceramide sulfotransferase, which catalyzes the sulfation of membrane glycolipids including the final step in the synthesis of sulfatide, a major lipid component of the myelin sheath. This gene exhibits elevated expression in ovarian epithelial carcinoma and the encoded enzyme exhibits elevated activity in renal cell carcinoma. Mutations in this gene may be associated with reduced insulin resistance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit hindlimb weakness and progressive ataxia beginning at six weeks of age. Homozygous males exhibit sterility with a block in spermatogenesis prior to the first meiotic division. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A T 7: 45,665,892 (GRCm39) W243R probably damaging Het
Ablim1 T G 19: 57,227,612 (GRCm39) K18Q probably benign Het
Adamts18 T A 8: 114,504,570 (GRCm39) N174Y possibly damaging Het
Afg2a T C 3: 37,486,058 (GRCm39) V260A probably benign Het
Agbl2 A G 2: 90,614,437 (GRCm39) H23R probably benign Het
Akap6 T G 12: 53,057,335 (GRCm39) Y934D probably damaging Het
Alas1 C T 9: 106,111,261 (GRCm39) S635N probably benign Het
Ankrd24 A G 10: 81,478,133 (GRCm39) probably null Het
Atp6v0a4 A G 6: 38,037,917 (GRCm39) L560P probably damaging Het
Cacng1 C T 11: 107,607,118 (GRCm39) V34M possibly damaging Het
Clcn3 C T 8: 61,387,551 (GRCm39) A233T probably damaging Het
Cntnap3 A G 13: 64,946,949 (GRCm39) F160S probably damaging Het
Ctnnd2 A G 15: 30,881,276 (GRCm39) S719G probably damaging Het
Exosc2 G A 2: 31,564,755 (GRCm39) V107I probably benign Het
Fam83b C A 9: 76,399,085 (GRCm39) V673F probably benign Het
Fras1 T C 5: 96,927,929 (GRCm39) F3781L probably damaging Het
Garem1 T C 18: 21,281,370 (GRCm39) I329V probably benign Het
Gli3 G A 13: 15,900,296 (GRCm39) G1228S possibly damaging Het
Gpbp1l1 T C 4: 116,431,558 (GRCm39) F72S possibly damaging Het
Hao1 T A 2: 134,390,181 (GRCm39) M53L probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,193,999 (GRCm39) probably benign Het
Iqcm A G 8: 76,480,083 (GRCm39) E347G probably damaging Het
Itpr3 G A 17: 27,337,651 (GRCm39) probably benign Het
Kcnrg A G 14: 61,845,106 (GRCm39) I49V possibly damaging Het
Lrrc8e G A 8: 4,285,346 (GRCm39) G524S probably benign Het
Lrrn1 A T 6: 107,545,261 (GRCm39) Y353F probably damaging Het
Mdn1 A G 4: 32,739,849 (GRCm39) D3701G possibly damaging Het
Mtmr2 A G 9: 13,716,767 (GRCm39) T623A probably benign Het
Ndst4 C A 3: 125,508,296 (GRCm39) S287* probably null Het
Ntrk3 A C 7: 77,952,480 (GRCm39) M579R probably benign Het
Oas1a G A 5: 121,037,317 (GRCm39) L237F probably damaging Het
Or2aj4 T C 16: 19,385,270 (GRCm39) D121G probably benign Het
Or5bw2 A T 7: 6,573,818 (GRCm39) Y276F probably damaging Het
Or7e166 T C 9: 19,624,939 (GRCm39) M272T probably benign Het
Paqr5 T A 9: 61,863,507 (GRCm39) I272F probably damaging Het
Pcdha11 T A 18: 37,140,591 (GRCm39) V740E probably damaging Het
Pdgfra A C 5: 75,328,588 (GRCm39) N240T possibly damaging Het
Plbd2 G A 5: 120,632,445 (GRCm39) Q186* probably null Het
Plce1 G A 19: 38,766,337 (GRCm39) E2121K possibly damaging Het
Ppargc1a C A 5: 51,653,080 (GRCm39) G161C probably damaging Het
Ptprk T C 10: 28,210,476 (GRCm39) I166T possibly damaging Het
Rhox8 GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT X: 36,966,991 (GRCm39) probably benign Het
Rpap2 T A 5: 107,768,455 (GRCm39) L431Q probably damaging Het
Rslcan18 T A 13: 67,250,128 (GRCm39) K160* probably null Het
Sema7a T C 9: 57,862,188 (GRCm39) F180L probably benign Het
Sh2d3c C T 2: 32,643,039 (GRCm39) L741F probably damaging Het
Shank1 G A 7: 43,962,342 (GRCm39) S71N unknown Het
Skic2 A T 17: 35,060,078 (GRCm39) D897E probably benign Het
Skint6 C T 4: 112,664,037 (GRCm39) probably null Het
Slc35f3 T C 8: 127,108,993 (GRCm39) S181P probably damaging Het
Slc4a9 A T 18: 36,662,269 (GRCm39) E127V probably null Het
Speg C T 1: 75,364,735 (GRCm39) T372I probably damaging Het
Syce1l A G 8: 114,381,735 (GRCm39) T204A probably benign Het
Tas2r138 T A 6: 40,589,392 (GRCm39) M285L probably benign Het
Tbc1d10a G C 11: 4,163,604 (GRCm39) K285N probably damaging Het
Trim9 T A 12: 70,393,228 (GRCm39) M239L probably benign Het
Trp53bp1 A G 2: 121,039,761 (GRCm39) S1293P probably benign Het
Uaca C T 9: 60,779,498 (GRCm39) T1295M possibly damaging Het
Ubald1 G T 16: 4,693,433 (GRCm39) Q161K possibly damaging Het
Ugt1a10 C T 1: 88,143,982 (GRCm39) R201C probably damaging Het
Vps45 T G 3: 95,950,237 (GRCm39) T231P probably damaging Het
Wdr17 A T 8: 55,088,512 (GRCm39) D1186E probably benign Het
Zfp534 G A 4: 147,766,731 (GRCm39) T8I probably benign Het
Zfp68 T C 5: 138,605,517 (GRCm39) N269D probably benign Het
Other mutations in Gal3st1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Gal3st1 APN 11 3,949,070 (GRCm39) utr 3 prime probably benign
IGL01010:Gal3st1 APN 11 3,946,914 (GRCm39) utr 5 prime probably benign
IGL01079:Gal3st1 APN 11 3,948,564 (GRCm39) missense probably damaging 1.00
IGL01306:Gal3st1 APN 11 3,948,405 (GRCm39) missense probably damaging 1.00
IGL01614:Gal3st1 APN 11 3,948,996 (GRCm39) missense probably damaging 1.00
IGL01990:Gal3st1 APN 11 3,948,741 (GRCm39) missense probably damaging 1.00
IGL02439:Gal3st1 APN 11 3,948,110 (GRCm39) missense possibly damaging 0.95
R0306:Gal3st1 UTSW 11 3,948,546 (GRCm39) missense probably damaging 1.00
R1075:Gal3st1 UTSW 11 3,948,509 (GRCm39) missense possibly damaging 0.80
R1171:Gal3st1 UTSW 11 3,948,931 (GRCm39) missense probably damaging 1.00
R1874:Gal3st1 UTSW 11 3,948,231 (GRCm39) missense probably damaging 1.00
R2230:Gal3st1 UTSW 11 3,948,282 (GRCm39) missense probably benign 0.31
R2231:Gal3st1 UTSW 11 3,948,282 (GRCm39) missense probably benign 0.31
R2232:Gal3st1 UTSW 11 3,948,282 (GRCm39) missense probably benign 0.31
R2985:Gal3st1 UTSW 11 3,948,618 (GRCm39) missense probably damaging 1.00
R3552:Gal3st1 UTSW 11 3,948,110 (GRCm39) missense possibly damaging 0.90
R6737:Gal3st1 UTSW 11 3,948,903 (GRCm39) missense probably benign 0.00
R7027:Gal3st1 UTSW 11 3,949,002 (GRCm39) missense probably damaging 0.96
R7106:Gal3st1 UTSW 11 3,948,509 (GRCm39) missense probably damaging 1.00
R7288:Gal3st1 UTSW 11 3,948,651 (GRCm39) missense probably damaging 0.98
R7288:Gal3st1 UTSW 11 3,948,609 (GRCm39) missense probably damaging 1.00
R7290:Gal3st1 UTSW 11 3,948,093 (GRCm39) missense possibly damaging 0.70
R7438:Gal3st1 UTSW 11 3,948,227 (GRCm39) missense probably benign 0.00
R7934:Gal3st1 UTSW 11 3,948,405 (GRCm39) missense probably damaging 1.00
R9046:Gal3st1 UTSW 11 3,948,278 (GRCm39) missense probably benign 0.05
RF020:Gal3st1 UTSW 11 3,948,153 (GRCm39) missense possibly damaging 0.75
Z1088:Gal3st1 UTSW 11 3,947,984 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGATAGTAGCCTGGACCCG -3'
(R):5'- AGGATGGACTTGATGCCCAG -3'

Sequencing Primer
(F):5'- GCTACTGCAGGAGTACTT -3'
(R):5'- TTGGCCGCCATCTATGCAG -3'
Posted On 2022-06-15