Incidental Mutation 'R9475:Cacng1'
ID 715725
Institutional Source Beutler Lab
Gene Symbol Cacng1
Ensembl Gene ENSMUSG00000020722
Gene Name calcium channel, voltage-dependent, gamma subunit 1
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.084) question?
Stock # R9475 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 107703218-107716522 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 107716292 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 34 (V34M)
Ref Sequence ENSEMBL: ENSMUSP00000021065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021065]
AlphaFold O70578
Predicted Effect possibly damaging
Transcript: ENSMUST00000021065
AA Change: V34M

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021065
Gene: ENSMUSG00000020722
AA Change: V34M

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 6 200 6.3e-12 PFAM
Pfam:Claudin_2 17 202 2.6e-41 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-dependent calcium channels are composed of five subunits. The protein encoded by this gene represents one of these subunits, gamma, and is one of two known gamma subunit proteins. This particular gamma subunit is part of skeletal muscle 1,4-dihydropyridine-sensitive calcium channels and is an integral membrane protein that plays a role in excitation-contraction coupling. This gene is part of a functionally diverse eight-member protein subfamily of the PMP-22/EMP/MP20 family and is located in a cluster with two family members that function as transmembrane AMPA receptor regulatory proteins (TARPs). [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for null mutations display abnormal muscle calcium currents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A T 7: 46,016,468 W243R probably damaging Het
Ablim1 T G 19: 57,239,180 K18Q probably benign Het
Adamts18 T A 8: 113,777,938 N174Y possibly damaging Het
Agbl2 A G 2: 90,784,093 H23R probably benign Het
Akap6 T G 12: 53,010,552 Y934D probably damaging Het
Alas1 C T 9: 106,234,062 S635N probably benign Het
Ankrd24 A G 10: 81,642,299 probably null Het
Atp6v0a4 A G 6: 38,060,982 L560P probably damaging Het
Clcn3 C T 8: 60,934,517 A233T probably damaging Het
Cntnap3 A G 13: 64,799,135 F160S probably damaging Het
Ctnnd2 A G 15: 30,881,130 S719G probably damaging Het
Exosc2 G A 2: 31,674,743 V107I probably benign Het
Fam83b C A 9: 76,491,803 V673F probably benign Het
Fras1 T C 5: 96,780,070 F3781L probably damaging Het
Gal3st1 T A 11: 3,998,660 L289H probably damaging Het
Garem1 T C 18: 21,148,313 I329V probably benign Het
Gli3 G A 13: 15,725,711 G1228S possibly damaging Het
Gpbp1l1 T C 4: 116,574,361 F72S possibly damaging Het
Hao1 T A 2: 134,548,261 M53L probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Iqcm A G 8: 75,753,455 E347G probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kcnrg A G 14: 61,607,657 I49V possibly damaging Het
Lrrc8e G A 8: 4,235,346 G524S probably benign Het
Lrrn1 A T 6: 107,568,300 Y353F probably damaging Het
Mdn1 A G 4: 32,739,849 D3701G possibly damaging Het
Mtmr2 A G 9: 13,805,471 T623A probably benign Het
Ndst4 C A 3: 125,714,647 S287* probably null Het
Ntrk3 A C 7: 78,302,732 M579R probably benign Het
Oas1a G A 5: 120,899,254 L237F probably damaging Het
Olfr1350 A T 7: 6,570,819 Y276F probably damaging Het
Olfr169 T C 16: 19,566,520 D121G probably benign Het
Olfr857 T C 9: 19,713,643 M272T probably benign Het
Paqr5 T A 9: 61,956,225 I272F probably damaging Het
Pcdha11 T A 18: 37,007,538 V740E probably damaging Het
Pdgfra A C 5: 75,167,927 N240T possibly damaging Het
Plbd2 G A 5: 120,494,380 Q186* probably null Het
Plce1 G A 19: 38,777,893 E2121K possibly damaging Het
Ppargc1a C A 5: 51,495,738 G161C probably damaging Het
Ptprk T C 10: 28,334,480 I166T possibly damaging Het
Rhox8 GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT X: 37,878,114 probably benign Het
Rpap2 T A 5: 107,620,589 L431Q probably damaging Het
Rslcan18 T A 13: 67,102,064 K160* probably null Het
Sema7a T C 9: 57,954,905 F180L probably benign Het
Sh2d3c C T 2: 32,753,027 L741F probably damaging Het
Shank1 G A 7: 44,312,918 S71N unknown Het
Skint6 C T 4: 112,806,840 probably null Het
Skiv2l A T 17: 34,841,102 D897E probably benign Het
Slc35f3 T C 8: 126,382,254 S181P probably damaging Het
Slc4a9 A T 18: 36,529,216 E127V probably null Het
Spata5 T C 3: 37,431,909 V260A probably benign Het
Speg C T 1: 75,388,091 T372I probably damaging Het
Syce1l A G 8: 113,655,103 T204A probably benign Het
Tas2r138 T A 6: 40,612,458 M285L probably benign Het
Tbc1d10a G C 11: 4,213,604 K285N probably damaging Het
Trim9 T A 12: 70,346,454 M239L probably benign Het
Trp53bp1 A G 2: 121,209,280 S1293P probably benign Het
Uaca C T 9: 60,872,216 T1295M possibly damaging Het
Ubald1 G T 16: 4,875,569 Q161K possibly damaging Het
Ugt1a10 C T 1: 88,216,260 R201C probably damaging Het
Vps45 T G 3: 96,042,925 T231P probably damaging Het
Wdr17 A T 8: 54,635,477 D1186E probably benign Het
Zfp534 G A 4: 147,682,274 T8I probably benign Het
Zfp68 T C 5: 138,607,255 N269D probably benign Het
Other mutations in Cacng1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Cacng1 APN 11 107704369 missense probably benign
IGL02623:Cacng1 APN 11 107704319 missense probably damaging 1.00
R0920:Cacng1 UTSW 11 107705856 splice site probably benign
R2042:Cacng1 UTSW 11 107704308 missense probably damaging 1.00
R3906:Cacng1 UTSW 11 107716292 missense probably benign 0.00
R3908:Cacng1 UTSW 11 107716292 missense probably benign 0.00
R3909:Cacng1 UTSW 11 107716292 missense probably benign 0.00
R5247:Cacng1 UTSW 11 107716279 missense probably benign 0.45
R7158:Cacng1 UTSW 11 107703839 missense probably damaging 0.99
R7473:Cacng1 UTSW 11 107716192 missense probably damaging 0.97
R9171:Cacng1 UTSW 11 107716234 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTACCTCAGGCTGTTTCC -3'
(R):5'- TGCCACCATCTAGCTAGCTG -3'

Sequencing Primer
(F):5'- CTTATCTTGGAGTCTTGAAAGGAC -3'
(R):5'- ATCTAGCTAGCTGCCTGGGAG -3'
Posted On 2022-06-15