Incidental Mutation 'R9475:Skiv2l'
ID 715736
Institutional Source Beutler Lab
Gene Symbol Skiv2l
Ensembl Gene ENSMUSG00000040356
Gene Name superkiller viralicidic activity 2-like (S. cerevisiae)
Synonyms 4930534J06Rik, Ski2w
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9475 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 34839228-34850210 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 34841102 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 897 (D897E)
Ref Sequence ENSEMBL: ENSMUSP00000036265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046022] [ENSMUST00000046244] [ENSMUST00000077477] [ENSMUST00000159333] [ENSMUST00000161885] [ENSMUST00000172612] [ENSMUST00000173063] [ENSMUST00000173415] [ENSMUST00000173874] [ENSMUST00000173995] [ENSMUST00000174092] [ENSMUST00000180043]
AlphaFold Q6NZR5
Predicted Effect probably benign
Transcript: ENSMUST00000046022
AA Change: D897E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000036265
Gene: ENSMUSG00000040356
AA Change: D897E

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
low complexity region 171 176 N/A INTRINSIC
low complexity region 208 237 N/A INTRINSIC
low complexity region 269 279 N/A INTRINSIC
DEXDc 304 487 3.61e-28 SMART
low complexity region 583 592 N/A INTRINSIC
HELICc 619 705 8.63e-17 SMART
Pfam:rRNA_proc-arch 760 1044 9.7e-39 PFAM
DSHCT 1067 1243 7.67e-77 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000046244
SMART Domains Protein: ENSMUSP00000047018
Gene: ENSMUSG00000040482

DomainStartEndE-ValueType
low complexity region 168 184 N/A INTRINSIC
Pfam:RAI1 235 303 2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000077477
SMART Domains Protein: ENSMUSP00000076686
Gene: ENSMUSG00000061207

DomainStartEndE-ValueType
Pfam:Stk19 37 251 1e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159333
SMART Domains Protein: ENSMUSP00000125311
Gene: ENSMUSG00000061207

DomainStartEndE-ValueType
Pfam:Stk19 1 129 3.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161885
Predicted Effect probably benign
Transcript: ENSMUST00000172612
SMART Domains Protein: ENSMUSP00000133376
Gene: ENSMUSG00000040482

DomainStartEndE-ValueType
Pfam:RAI1 5 73 1.6e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173063
Predicted Effect probably benign
Transcript: ENSMUST00000173415
AA Change: D149E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134209
Gene: ENSMUSG00000040356
AA Change: D149E

DomainStartEndE-ValueType
PDB:4A4Z|A 10 81 8e-14 PDB
Blast:DEXDc 19 76 2e-29 BLAST
Blast:DEXDc 136 242 9e-28 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173874
SMART Domains Protein: ENSMUSP00000134332
Gene: ENSMUSG00000040482

DomainStartEndE-ValueType
low complexity region 168 184 N/A INTRINSIC
Pfam:RAI1 235 303 4.2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173995
SMART Domains Protein: ENSMUSP00000134583
Gene: ENSMUSG00000040482

DomainStartEndE-ValueType
PDB:3FQJ|A 1 144 5e-99 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000174092
SMART Domains Protein: ENSMUSP00000133587
Gene: ENSMUSG00000040482

DomainStartEndE-ValueType
Pfam:RAI1 110 151 5.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174569
SMART Domains Protein: ENSMUSP00000133448
Gene: ENSMUSG00000040482

DomainStartEndE-ValueType
Pfam:RAI1 15 65 1.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174684
SMART Domains Protein: ENSMUSP00000134653
Gene: ENSMUSG00000040482

DomainStartEndE-ValueType
PDB:3FQJ|A 2 48 1e-11 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000180043
SMART Domains Protein: ENSMUSP00000137234
Gene: ENSMUSG00000040482

DomainStartEndE-ValueType
low complexity region 168 184 N/A INTRINSIC
Pfam:RAI1 235 302 2e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a human homologue of yeast SKI2 and may be involved in antiviral activity by blocking translation of poly(A) deficient mRNAs. This gene is located in the class III region of the major histocompatibility complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A T 7: 46,016,468 W243R probably damaging Het
Ablim1 T G 19: 57,239,180 K18Q probably benign Het
Adamts18 T A 8: 113,777,938 N174Y possibly damaging Het
Agbl2 A G 2: 90,784,093 H23R probably benign Het
Akap6 T G 12: 53,010,552 Y934D probably damaging Het
Alas1 C T 9: 106,234,062 S635N probably benign Het
Ankrd24 A G 10: 81,642,299 probably null Het
Atp6v0a4 A G 6: 38,060,982 L560P probably damaging Het
Cacng1 C T 11: 107,716,292 V34M possibly damaging Het
Clcn3 C T 8: 60,934,517 A233T probably damaging Het
Cntnap3 A G 13: 64,799,135 F160S probably damaging Het
Ctnnd2 A G 15: 30,881,130 S719G probably damaging Het
Exosc2 G A 2: 31,674,743 V107I probably benign Het
Fam83b C A 9: 76,491,803 V673F probably benign Het
Fras1 T C 5: 96,780,070 F3781L probably damaging Het
Gal3st1 T A 11: 3,998,660 L289H probably damaging Het
Garem1 T C 18: 21,148,313 I329V probably benign Het
Gli3 G A 13: 15,725,711 G1228S possibly damaging Het
Gpbp1l1 T C 4: 116,574,361 F72S possibly damaging Het
Hao1 T A 2: 134,548,261 M53L probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Iqcm A G 8: 75,753,455 E347G probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kcnrg A G 14: 61,607,657 I49V possibly damaging Het
Lrrc8e G A 8: 4,235,346 G524S probably benign Het
Lrrn1 A T 6: 107,568,300 Y353F probably damaging Het
Mdn1 A G 4: 32,739,849 D3701G possibly damaging Het
Mtmr2 A G 9: 13,805,471 T623A probably benign Het
Ndst4 C A 3: 125,714,647 S287* probably null Het
Ntrk3 A C 7: 78,302,732 M579R probably benign Het
Oas1a G A 5: 120,899,254 L237F probably damaging Het
Olfr1350 A T 7: 6,570,819 Y276F probably damaging Het
Olfr169 T C 16: 19,566,520 D121G probably benign Het
Olfr857 T C 9: 19,713,643 M272T probably benign Het
Paqr5 T A 9: 61,956,225 I272F probably damaging Het
Pcdha11 T A 18: 37,007,538 V740E probably damaging Het
Pdgfra A C 5: 75,167,927 N240T possibly damaging Het
Plbd2 G A 5: 120,494,380 Q186* probably null Het
Plce1 G A 19: 38,777,893 E2121K possibly damaging Het
Ppargc1a C A 5: 51,495,738 G161C probably damaging Het
Ptprk T C 10: 28,334,480 I166T possibly damaging Het
Rhox8 GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT X: 37,878,114 probably benign Het
Rpap2 T A 5: 107,620,589 L431Q probably damaging Het
Rslcan18 T A 13: 67,102,064 K160* probably null Het
Sema7a T C 9: 57,954,905 F180L probably benign Het
Sh2d3c C T 2: 32,753,027 L741F probably damaging Het
Shank1 G A 7: 44,312,918 S71N unknown Het
Skint6 C T 4: 112,806,840 probably null Het
Slc35f3 T C 8: 126,382,254 S181P probably damaging Het
Slc4a9 A T 18: 36,529,216 E127V probably null Het
Spata5 T C 3: 37,431,909 V260A probably benign Het
Speg C T 1: 75,388,091 T372I probably damaging Het
Syce1l A G 8: 113,655,103 T204A probably benign Het
Tas2r138 T A 6: 40,612,458 M285L probably benign Het
Tbc1d10a G C 11: 4,213,604 K285N probably damaging Het
Trim9 T A 12: 70,346,454 M239L probably benign Het
Trp53bp1 A G 2: 121,209,280 S1293P probably benign Het
Uaca C T 9: 60,872,216 T1295M possibly damaging Het
Ubald1 G T 16: 4,875,569 Q161K possibly damaging Het
Ugt1a10 C T 1: 88,216,260 R201C probably damaging Het
Vps45 T G 3: 96,042,925 T231P probably damaging Het
Wdr17 A T 8: 54,635,477 D1186E probably benign Het
Zfp534 G A 4: 147,682,274 T8I probably benign Het
Zfp68 T C 5: 138,607,255 N269D probably benign Het
Other mutations in Skiv2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Skiv2l APN 17 34839548 missense probably damaging 1.00
IGL00338:Skiv2l APN 17 34846667 missense probably damaging 0.99
IGL01284:Skiv2l APN 17 34839688 unclassified probably benign
IGL01308:Skiv2l APN 17 34840634 missense probably benign 0.19
IGL01874:Skiv2l APN 17 34841209 missense probably benign
IGL02114:Skiv2l APN 17 34841116 missense probably damaging 0.97
IGL02208:Skiv2l APN 17 34841675 missense probably damaging 0.99
IGL02274:Skiv2l APN 17 34845863 missense probably damaging 1.00
IGL02729:Skiv2l APN 17 34839605 missense possibly damaging 0.63
IGL02839:Skiv2l APN 17 34847798 missense probably benign
R0325:Skiv2l UTSW 17 34844815 missense possibly damaging 0.50
R1102:Skiv2l UTSW 17 34840106 missense probably benign 0.28
R1294:Skiv2l UTSW 17 34841064 splice site probably null
R1513:Skiv2l UTSW 17 34847444 missense probably damaging 1.00
R1557:Skiv2l UTSW 17 34848422 missense probably damaging 1.00
R1747:Skiv2l UTSW 17 34847806 missense probably benign 0.02
R2401:Skiv2l UTSW 17 34840385 missense probably benign
R3162:Skiv2l UTSW 17 34847813 nonsense probably null
R3162:Skiv2l UTSW 17 34847813 nonsense probably null
R3695:Skiv2l UTSW 17 34847912 missense probably damaging 1.00
R3700:Skiv2l UTSW 17 34849903 missense probably benign
R4654:Skiv2l UTSW 17 34849946 missense probably damaging 1.00
R4736:Skiv2l UTSW 17 34848197 missense possibly damaging 0.91
R4835:Skiv2l UTSW 17 34842921 missense possibly damaging 0.66
R5014:Skiv2l UTSW 17 34847425 missense probably benign 0.00
R5181:Skiv2l UTSW 17 34844826 missense probably benign 0.44
R5223:Skiv2l UTSW 17 34845166 critical splice donor site probably null
R5417:Skiv2l UTSW 17 34846598 missense probably damaging 0.98
R5623:Skiv2l UTSW 17 34847432 missense probably benign 0.00
R5878:Skiv2l UTSW 17 34846117 missense possibly damaging 0.83
R5979:Skiv2l UTSW 17 34841463 missense probably benign 0.01
R6412:Skiv2l UTSW 17 34840300 missense possibly damaging 0.92
R6501:Skiv2l UTSW 17 34844436 missense possibly damaging 0.95
R6532:Skiv2l UTSW 17 34844743 missense probably damaging 1.00
R6730:Skiv2l UTSW 17 34845190 nonsense probably null
R6732:Skiv2l UTSW 17 34845190 nonsense probably null
R6741:Skiv2l UTSW 17 34845190 nonsense probably null
R6742:Skiv2l UTSW 17 34845190 nonsense probably null
R6769:Skiv2l UTSW 17 34845190 nonsense probably null
R6771:Skiv2l UTSW 17 34845190 nonsense probably null
R7022:Skiv2l UTSW 17 34845207 missense possibly damaging 0.88
R7096:Skiv2l UTSW 17 34841470 missense probably benign
R7178:Skiv2l UTSW 17 34839464 missense probably benign
R7315:Skiv2l UTSW 17 34841169 missense probably benign 0.00
R7584:Skiv2l UTSW 17 34841675 missense possibly damaging 0.69
R7677:Skiv2l UTSW 17 34848164 missense probably benign 0.03
R7796:Skiv2l UTSW 17 34844418 missense probably damaging 1.00
R8071:Skiv2l UTSW 17 34849999 missense probably benign 0.22
R8407:Skiv2l UTSW 17 34841127 missense probably benign 0.00
R8991:Skiv2l UTSW 17 34840190 missense probably damaging 1.00
R9016:Skiv2l UTSW 17 34844664 missense probably damaging 0.98
R9021:Skiv2l UTSW 17 34846603 missense probably damaging 1.00
R9196:Skiv2l UTSW 17 34849901 missense probably benign 0.00
R9243:Skiv2l UTSW 17 34845222 missense probably benign 0.33
R9322:Skiv2l UTSW 17 34847463 critical splice acceptor site probably null
R9564:Skiv2l UTSW 17 34844782 missense probably benign
R9565:Skiv2l UTSW 17 34844782 missense probably benign
Z1176:Skiv2l UTSW 17 34841546 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCTCTTGCTAAAGTCCTCAG -3'
(R):5'- CAACTCAAGGGCTCTGTGTG -3'

Sequencing Primer
(F):5'- ATTCACCCGGAGCACTTTGGTAG -3'
(R):5'- CTGTGTGTGGGTCCCAAAGC -3'
Posted On 2022-06-15