Incidental Mutation 'R9475:Garem1'
ID 715737
Institutional Source Beutler Lab
Gene Symbol Garem1
Ensembl Gene ENSMUSG00000042680
Gene Name GRB2 associated regulator of MAPK1 subtype 1
Synonyms LOC381126, Garem, Fam59a
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.154) question?
Stock # R9475 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 21260399-21433196 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 21281370 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 329 (I329V)
Ref Sequence ENSEMBL: ENSMUSP00000048914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049260]
AlphaFold Q3UFT3
Predicted Effect probably benign
Transcript: ENSMUST00000049260
AA Change: I329V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000048914
Gene: ENSMUSG00000042680
AA Change: I329V

DomainStartEndE-ValueType
Pfam:CABIT 32 318 3.4e-79 PFAM
low complexity region 484 499 N/A INTRINSIC
low complexity region 512 518 N/A INTRINSIC
PDB:2DKZ|A 795 874 2e-40 PDB
Blast:SAM 808 875 2e-36 BLAST
SCOP:d1kw4a_ 812 873 4e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adaptor protein which functions in the epidermal growth factor (EGF) receptor-mediated signaling pathway. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A T 7: 45,665,892 (GRCm39) W243R probably damaging Het
Ablim1 T G 19: 57,227,612 (GRCm39) K18Q probably benign Het
Adamts18 T A 8: 114,504,570 (GRCm39) N174Y possibly damaging Het
Afg2a T C 3: 37,486,058 (GRCm39) V260A probably benign Het
Agbl2 A G 2: 90,614,437 (GRCm39) H23R probably benign Het
Akap6 T G 12: 53,057,335 (GRCm39) Y934D probably damaging Het
Alas1 C T 9: 106,111,261 (GRCm39) S635N probably benign Het
Ankrd24 A G 10: 81,478,133 (GRCm39) probably null Het
Atp6v0a4 A G 6: 38,037,917 (GRCm39) L560P probably damaging Het
Cacng1 C T 11: 107,607,118 (GRCm39) V34M possibly damaging Het
Clcn3 C T 8: 61,387,551 (GRCm39) A233T probably damaging Het
Cntnap3 A G 13: 64,946,949 (GRCm39) F160S probably damaging Het
Ctnnd2 A G 15: 30,881,276 (GRCm39) S719G probably damaging Het
Exosc2 G A 2: 31,564,755 (GRCm39) V107I probably benign Het
Fam83b C A 9: 76,399,085 (GRCm39) V673F probably benign Het
Fras1 T C 5: 96,927,929 (GRCm39) F3781L probably damaging Het
Gal3st1 T A 11: 3,948,660 (GRCm39) L289H probably damaging Het
Gli3 G A 13: 15,900,296 (GRCm39) G1228S possibly damaging Het
Gpbp1l1 T C 4: 116,431,558 (GRCm39) F72S possibly damaging Het
Hao1 T A 2: 134,390,181 (GRCm39) M53L probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,193,999 (GRCm39) probably benign Het
Iqcm A G 8: 76,480,083 (GRCm39) E347G probably damaging Het
Itpr3 G A 17: 27,337,651 (GRCm39) probably benign Het
Kcnrg A G 14: 61,845,106 (GRCm39) I49V possibly damaging Het
Lrrc8e G A 8: 4,285,346 (GRCm39) G524S probably benign Het
Lrrn1 A T 6: 107,545,261 (GRCm39) Y353F probably damaging Het
Mdn1 A G 4: 32,739,849 (GRCm39) D3701G possibly damaging Het
Mtmr2 A G 9: 13,716,767 (GRCm39) T623A probably benign Het
Ndst4 C A 3: 125,508,296 (GRCm39) S287* probably null Het
Ntrk3 A C 7: 77,952,480 (GRCm39) M579R probably benign Het
Oas1a G A 5: 121,037,317 (GRCm39) L237F probably damaging Het
Or2aj4 T C 16: 19,385,270 (GRCm39) D121G probably benign Het
Or5bw2 A T 7: 6,573,818 (GRCm39) Y276F probably damaging Het
Or7e166 T C 9: 19,624,939 (GRCm39) M272T probably benign Het
Paqr5 T A 9: 61,863,507 (GRCm39) I272F probably damaging Het
Pcdha11 T A 18: 37,140,591 (GRCm39) V740E probably damaging Het
Pdgfra A C 5: 75,328,588 (GRCm39) N240T possibly damaging Het
Plbd2 G A 5: 120,632,445 (GRCm39) Q186* probably null Het
Plce1 G A 19: 38,766,337 (GRCm39) E2121K possibly damaging Het
Ppargc1a C A 5: 51,653,080 (GRCm39) G161C probably damaging Het
Ptprk T C 10: 28,210,476 (GRCm39) I166T possibly damaging Het
Rhox8 GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT X: 36,966,991 (GRCm39) probably benign Het
Rpap2 T A 5: 107,768,455 (GRCm39) L431Q probably damaging Het
Rslcan18 T A 13: 67,250,128 (GRCm39) K160* probably null Het
Sema7a T C 9: 57,862,188 (GRCm39) F180L probably benign Het
Sh2d3c C T 2: 32,643,039 (GRCm39) L741F probably damaging Het
Shank1 G A 7: 43,962,342 (GRCm39) S71N unknown Het
Skic2 A T 17: 35,060,078 (GRCm39) D897E probably benign Het
Skint6 C T 4: 112,664,037 (GRCm39) probably null Het
Slc35f3 T C 8: 127,108,993 (GRCm39) S181P probably damaging Het
Slc4a9 A T 18: 36,662,269 (GRCm39) E127V probably null Het
Speg C T 1: 75,364,735 (GRCm39) T372I probably damaging Het
Syce1l A G 8: 114,381,735 (GRCm39) T204A probably benign Het
Tas2r138 T A 6: 40,589,392 (GRCm39) M285L probably benign Het
Tbc1d10a G C 11: 4,163,604 (GRCm39) K285N probably damaging Het
Trim9 T A 12: 70,393,228 (GRCm39) M239L probably benign Het
Trp53bp1 A G 2: 121,039,761 (GRCm39) S1293P probably benign Het
Uaca C T 9: 60,779,498 (GRCm39) T1295M possibly damaging Het
Ubald1 G T 16: 4,693,433 (GRCm39) Q161K possibly damaging Het
Ugt1a10 C T 1: 88,143,982 (GRCm39) R201C probably damaging Het
Vps45 T G 3: 95,950,237 (GRCm39) T231P probably damaging Het
Wdr17 A T 8: 55,088,512 (GRCm39) D1186E probably benign Het
Zfp534 G A 4: 147,766,731 (GRCm39) T8I probably benign Het
Zfp68 T C 5: 138,605,517 (GRCm39) N269D probably benign Het
Other mutations in Garem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Garem1 APN 18 21,281,714 (GRCm39) missense probably damaging 1.00
IGL01588:Garem1 APN 18 21,262,854 (GRCm39) missense probably damaging 0.99
IGL02171:Garem1 APN 18 21,262,298 (GRCm39) missense probably damaging 0.98
IGL02270:Garem1 APN 18 21,281,507 (GRCm39) missense probably damaging 1.00
IGL03149:Garem1 APN 18 21,264,523 (GRCm39) missense probably damaging 1.00
R0136:Garem1 UTSW 18 21,263,048 (GRCm39) missense probably damaging 0.96
R0285:Garem1 UTSW 18 21,262,669 (GRCm39) missense probably benign
R0361:Garem1 UTSW 18 21,432,801 (GRCm39) nonsense probably null
R1068:Garem1 UTSW 18 21,301,812 (GRCm39) missense probably benign 0.00
R1537:Garem1 UTSW 18 21,301,931 (GRCm39) splice site probably null
R1726:Garem1 UTSW 18 21,281,319 (GRCm39) missense probably damaging 0.99
R1826:Garem1 UTSW 18 21,262,509 (GRCm39) missense probably benign 0.00
R2140:Garem1 UTSW 18 21,262,431 (GRCm39) missense probably damaging 1.00
R3714:Garem1 UTSW 18 21,281,947 (GRCm39) missense probably damaging 1.00
R3937:Garem1 UTSW 18 21,281,863 (GRCm39) nonsense probably null
R4362:Garem1 UTSW 18 21,369,172 (GRCm39) missense possibly damaging 0.62
R4441:Garem1 UTSW 18 21,301,807 (GRCm39) missense possibly damaging 0.92
R4747:Garem1 UTSW 18 21,263,000 (GRCm39) missense probably benign
R4814:Garem1 UTSW 18 21,281,173 (GRCm39) missense probably damaging 1.00
R4831:Garem1 UTSW 18 21,262,825 (GRCm39) missense probably benign 0.01
R4838:Garem1 UTSW 18 21,280,950 (GRCm39) missense probably benign 0.00
R5805:Garem1 UTSW 18 21,281,492 (GRCm39) missense probably benign 0.04
R5963:Garem1 UTSW 18 21,262,487 (GRCm39) missense probably benign 0.45
R5982:Garem1 UTSW 18 21,281,408 (GRCm39) missense possibly damaging 0.64
R6134:Garem1 UTSW 18 21,262,881 (GRCm39) missense probably benign 0.00
R6242:Garem1 UTSW 18 21,262,229 (GRCm39) missense possibly damaging 0.72
R6453:Garem1 UTSW 18 21,281,796 (GRCm39) missense probably damaging 0.99
R6485:Garem1 UTSW 18 21,262,894 (GRCm39) missense probably benign 0.00
R6596:Garem1 UTSW 18 21,281,796 (GRCm39) missense probably damaging 0.99
R6662:Garem1 UTSW 18 21,281,304 (GRCm39) missense probably benign 0.45
R6883:Garem1 UTSW 18 21,262,769 (GRCm39) missense probably benign
R6937:Garem1 UTSW 18 21,280,827 (GRCm39) missense probably benign 0.00
R7027:Garem1 UTSW 18 21,263,051 (GRCm39) missense probably benign
R7256:Garem1 UTSW 18 21,281,811 (GRCm39) missense probably damaging 1.00
R7534:Garem1 UTSW 18 21,432,973 (GRCm39) start gained probably benign
R7620:Garem1 UTSW 18 21,262,898 (GRCm39) missense probably benign
R7869:Garem1 UTSW 18 21,432,757 (GRCm39) missense probably damaging 1.00
R7963:Garem1 UTSW 18 21,281,844 (GRCm39) missense probably damaging 0.98
R8058:Garem1 UTSW 18 21,281,621 (GRCm39) missense probably damaging 1.00
R8953:Garem1 UTSW 18 21,264,388 (GRCm39) critical splice donor site probably null
R9273:Garem1 UTSW 18 21,281,274 (GRCm39) missense probably damaging 0.99
R9411:Garem1 UTSW 18 21,369,057 (GRCm39) critical splice donor site probably null
R9789:Garem1 UTSW 18 21,262,985 (GRCm39) missense possibly damaging 0.81
Z1176:Garem1 UTSW 18 21,281,382 (GRCm39) missense probably damaging 1.00
Z1176:Garem1 UTSW 18 21,262,849 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATTGTTGCCATACACACAGAC -3'
(R):5'- TCCACTTCATTAGAGAGGGGC -3'

Sequencing Primer
(F):5'- TGTTGCCATACACACAGACTGAGAG -3'
(R):5'- GGCACCGCTACAAGTTTGTGAAC -3'
Posted On 2022-06-15