Incidental Mutation 'R9475:Plce1'
ID 715740
Institutional Source Beutler Lab
Gene Symbol Plce1
Ensembl Gene ENSMUSG00000024998
Gene Name phospholipase C, epsilon 1
Synonyms 4933403A21Rik, PLCepsilon
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.587) question?
Stock # R9475 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 38481109-38785030 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 38777893 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 2121 (E2121K)
Ref Sequence ENSEMBL: ENSMUSP00000138330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169713] [ENSMUST00000182267] [ENSMUST00000182481]
AlphaFold Q8K4S1
Predicted Effect possibly damaging
Transcript: ENSMUST00000169713
AA Change: E2107K

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130604
Gene: ENSMUSG00000024998
AA Change: E2107K

DomainStartEndE-ValueType
low complexity region 471 489 N/A INTRINSIC
RasGEF 525 828 8.06e-9 SMART
low complexity region 1162 1172 N/A INTRINSIC
Pfam:EF-hand_like 1305 1369 7.6e-11 PFAM
PLCXc 1373 1521 1.05e-81 SMART
low complexity region 1561 1575 N/A INTRINSIC
SCOP:d1qasa3 1634 1662 1e-3 SMART
low complexity region 1666 1680 N/A INTRINSIC
PLCYc 1710 1826 4.28e-46 SMART
C2 1850 1948 3.7e-10 SMART
PDB:2BYE|A 1986 2094 6e-47 PDB
RA 2115 2218 1.12e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000182267
AA Change: E2121K

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138330
Gene: ENSMUSG00000024998
AA Change: E2121K

DomainStartEndE-ValueType
low complexity region 471 489 N/A INTRINSIC
RasGEF 525 828 8.06e-9 SMART
low complexity region 1162 1172 N/A INTRINSIC
Pfam:EF-hand_like 1305 1369 5.9e-11 PFAM
PLCXc 1373 1521 1.05e-81 SMART
low complexity region 1552 1581 N/A INTRINSIC
SCOP:d1qasa3 1648 1676 1e-3 SMART
low complexity region 1680 1694 N/A INTRINSIC
PLCYc 1724 1840 4.28e-46 SMART
C2 1864 1962 3.7e-10 SMART
PDB:2BYE|A 2000 2108 6e-47 PDB
RA 2129 2232 1.12e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000182481
AA Change: E2107K

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138360
Gene: ENSMUSG00000024998
AA Change: E2107K

DomainStartEndE-ValueType
low complexity region 471 489 N/A INTRINSIC
RasGEF 525 828 8.06e-9 SMART
low complexity region 1162 1172 N/A INTRINSIC
Pfam:EF-hand_like 1305 1369 8e-11 PFAM
PLCXc 1373 1521 1.05e-81 SMART
low complexity region 1561 1575 N/A INTRINSIC
SCOP:d1qasa3 1634 1662 1e-3 SMART
low complexity region 1666 1680 N/A INTRINSIC
PLCYc 1710 1826 4.28e-46 SMART
C2 1850 1948 3.7e-10 SMART
PDB:2BYE|A 1986 2094 6e-47 PDB
RA 2115 2218 1.12e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phospholipase enzyme that catalyzes the hydrolysis of phosphatidylinositol-4,5-bisphosphate to generate two second messengers: inositol 1,4,5-triphosphate (IP3) and diacylglycerol (DAG). These second messengers subsequently regulate various processes affecting cell growth, differentiation, and gene expression. This enzyme is regulated by small monomeric GTPases of the Ras and Rho families and by heterotrimeric G proteins. In addition to its phospholipase C catalytic activity, this enzyme has an N-terminal domain with guanine nucleotide exchange (GEF) activity. Mutations in this gene cause early-onset nephrotic syndrome; characterized by proteinuria, edema, and diffuse mesangial sclerosis or focal and segmental glomerulosclerosis. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous mutation of this gene results in a congenital semilunar valvulogenesis defect which causes regurgitation and stenosis, and decreased incidence of induced skin tumors. Another mutant exhibits decreased cardiac contraction and increased hypertrophy in response to chronic stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A T 7: 46,016,468 W243R probably damaging Het
Ablim1 T G 19: 57,239,180 K18Q probably benign Het
Adamts18 T A 8: 113,777,938 N174Y possibly damaging Het
Agbl2 A G 2: 90,784,093 H23R probably benign Het
Akap6 T G 12: 53,010,552 Y934D probably damaging Het
Alas1 C T 9: 106,234,062 S635N probably benign Het
Ankrd24 A G 10: 81,642,299 probably null Het
Atp6v0a4 A G 6: 38,060,982 L560P probably damaging Het
Cacng1 C T 11: 107,716,292 V34M possibly damaging Het
Clcn3 C T 8: 60,934,517 A233T probably damaging Het
Cntnap3 A G 13: 64,799,135 F160S probably damaging Het
Ctnnd2 A G 15: 30,881,130 S719G probably damaging Het
Exosc2 G A 2: 31,674,743 V107I probably benign Het
Fam83b C A 9: 76,491,803 V673F probably benign Het
Fras1 T C 5: 96,780,070 F3781L probably damaging Het
Gal3st1 T A 11: 3,998,660 L289H probably damaging Het
Garem1 T C 18: 21,148,313 I329V probably benign Het
Gli3 G A 13: 15,725,711 G1228S possibly damaging Het
Gpbp1l1 T C 4: 116,574,361 F72S possibly damaging Het
Hao1 T A 2: 134,548,261 M53L probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Iqcm A G 8: 75,753,455 E347G probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kcnrg A G 14: 61,607,657 I49V possibly damaging Het
Lrrc8e G A 8: 4,235,346 G524S probably benign Het
Lrrn1 A T 6: 107,568,300 Y353F probably damaging Het
Mdn1 A G 4: 32,739,849 D3701G possibly damaging Het
Mtmr2 A G 9: 13,805,471 T623A probably benign Het
Ndst4 C A 3: 125,714,647 S287* probably null Het
Ntrk3 A C 7: 78,302,732 M579R probably benign Het
Oas1a G A 5: 120,899,254 L237F probably damaging Het
Olfr1350 A T 7: 6,570,819 Y276F probably damaging Het
Olfr169 T C 16: 19,566,520 D121G probably benign Het
Olfr857 T C 9: 19,713,643 M272T probably benign Het
Paqr5 T A 9: 61,956,225 I272F probably damaging Het
Pcdha11 T A 18: 37,007,538 V740E probably damaging Het
Pdgfra A C 5: 75,167,927 N240T possibly damaging Het
Plbd2 G A 5: 120,494,380 Q186* probably null Het
Ppargc1a C A 5: 51,495,738 G161C probably damaging Het
Ptprk T C 10: 28,334,480 I166T possibly damaging Het
Rhox8 GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT X: 37,878,114 probably benign Het
Rpap2 T A 5: 107,620,589 L431Q probably damaging Het
Rslcan18 T A 13: 67,102,064 K160* probably null Het
Sema7a T C 9: 57,954,905 F180L probably benign Het
Sh2d3c C T 2: 32,753,027 L741F probably damaging Het
Shank1 G A 7: 44,312,918 S71N unknown Het
Skint6 C T 4: 112,806,840 probably null Het
Skiv2l A T 17: 34,841,102 D897E probably benign Het
Slc35f3 T C 8: 126,382,254 S181P probably damaging Het
Slc4a9 A T 18: 36,529,216 E127V probably null Het
Spata5 T C 3: 37,431,909 V260A probably benign Het
Speg C T 1: 75,388,091 T372I probably damaging Het
Syce1l A G 8: 113,655,103 T204A probably benign Het
Tas2r138 T A 6: 40,612,458 M285L probably benign Het
Tbc1d10a G C 11: 4,213,604 K285N probably damaging Het
Trim9 T A 12: 70,346,454 M239L probably benign Het
Trp53bp1 A G 2: 121,209,280 S1293P probably benign Het
Uaca C T 9: 60,872,216 T1295M possibly damaging Het
Ubald1 G T 16: 4,875,569 Q161K possibly damaging Het
Ugt1a10 C T 1: 88,216,260 R201C probably damaging Het
Vps45 T G 3: 96,042,925 T231P probably damaging Het
Wdr17 A T 8: 54,635,477 D1186E probably benign Het
Zfp534 G A 4: 147,682,274 T8I probably benign Het
Zfp68 T C 5: 138,607,255 N269D probably benign Het
Other mutations in Plce1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Plce1 APN 19 38745788 missense probably damaging 0.99
IGL00336:Plce1 APN 19 38651906 missense probably damaging 1.00
IGL00430:Plce1 APN 19 38725017 missense probably damaging 1.00
IGL00466:Plce1 APN 19 38721029 missense probably damaging 0.99
IGL00477:Plce1 APN 19 38525132 missense probably benign 0.39
IGL00839:Plce1 APN 19 38698562 missense probably damaging 1.00
IGL01292:Plce1 APN 19 38651785 splice site probably benign
IGL01665:Plce1 APN 19 38524887 missense probably benign 0.01
IGL01826:Plce1 APN 19 38739238 splice site probably benign
IGL01833:Plce1 APN 19 38720981 missense probably damaging 1.00
IGL02201:Plce1 APN 19 38769446 splice site probably benign
IGL02276:Plce1 APN 19 38524757 missense probably benign 0.05
IGL02477:Plce1 APN 19 38719553 splice site probably benign
IGL02746:Plce1 APN 19 38698472 missense probably damaging 1.00
Angel_food UTSW 19 38727013 splice site probably benign
Heavenly UTSW 19 38777989 missense probably damaging 1.00
R0058:Plce1 UTSW 19 38525184 missense possibly damaging 0.90
R0058:Plce1 UTSW 19 38525184 missense possibly damaging 0.90
R0064:Plce1 UTSW 19 38780784 critical splice donor site probably null
R0116:Plce1 UTSW 19 38721821 missense probably benign
R0138:Plce1 UTSW 19 38524419 missense possibly damaging 0.49
R0240:Plce1 UTSW 19 38728886 missense probably damaging 0.99
R0240:Plce1 UTSW 19 38728886 missense probably damaging 0.99
R0504:Plce1 UTSW 19 38778021 splice site probably benign
R0506:Plce1 UTSW 19 38760138 missense probably benign 0.04
R0578:Plce1 UTSW 19 38777939 missense probably damaging 1.00
R0645:Plce1 UTSW 19 38777989 missense probably damaging 1.00
R0730:Plce1 UTSW 19 38716691 missense probably damaging 0.98
R0920:Plce1 UTSW 19 38736521 missense probably damaging 1.00
R1223:Plce1 UTSW 19 38702013 missense probably damaging 1.00
R1223:Plce1 UTSW 19 38767226 missense probably damaging 1.00
R1484:Plce1 UTSW 19 38705339 nonsense probably null
R1488:Plce1 UTSW 19 38716803 missense possibly damaging 0.92
R1598:Plce1 UTSW 19 38720996 missense probably damaging 1.00
R1624:Plce1 UTSW 19 38724775 missense probably damaging 1.00
R1732:Plce1 UTSW 19 38716838 missense possibly damaging 0.56
R1778:Plce1 UTSW 19 38780790 splice site probably benign
R1797:Plce1 UTSW 19 38758948 critical splice donor site probably null
R1872:Plce1 UTSW 19 38760077 missense probably damaging 1.00
R1876:Plce1 UTSW 19 38780623 missense probably damaging 1.00
R1991:Plce1 UTSW 19 38777924 missense probably damaging 1.00
R2080:Plce1 UTSW 19 38727013 splice site probably benign
R2103:Plce1 UTSW 19 38777924 missense probably damaging 1.00
R2376:Plce1 UTSW 19 38777986 missense probably benign 0.02
R2471:Plce1 UTSW 19 38779926 missense probably damaging 1.00
R2511:Plce1 UTSW 19 38760054 missense probably damaging 1.00
R2842:Plce1 UTSW 19 38524283 missense probably damaging 1.00
R3037:Plce1 UTSW 19 38777884 missense probably damaging 0.98
R3104:Plce1 UTSW 19 38620519 missense probably benign 0.00
R3700:Plce1 UTSW 19 38705337 missense probably damaging 1.00
R3750:Plce1 UTSW 19 38777899 missense probably benign
R3753:Plce1 UTSW 19 38651834 missense probably benign 0.09
R4027:Plce1 UTSW 19 38524265 missense probably damaging 1.00
R4057:Plce1 UTSW 19 38760119 missense probably damaging 1.00
R4376:Plce1 UTSW 19 38705447 critical splice donor site probably null
R4433:Plce1 UTSW 19 38767301 missense probably damaging 1.00
R4520:Plce1 UTSW 19 38524319 missense possibly damaging 0.46
R4521:Plce1 UTSW 19 38524319 missense possibly damaging 0.46
R4522:Plce1 UTSW 19 38524319 missense possibly damaging 0.46
R4524:Plce1 UTSW 19 38524319 missense possibly damaging 0.46
R4650:Plce1 UTSW 19 38524644 missense probably benign 0.30
R4673:Plce1 UTSW 19 38749396 missense possibly damaging 0.51
R4701:Plce1 UTSW 19 38725007 missense probably benign 0.33
R4828:Plce1 UTSW 19 38769499 missense probably damaging 1.00
R5103:Plce1 UTSW 19 38767215 missense probably damaging 1.00
R5112:Plce1 UTSW 19 38651833 missense probably benign 0.00
R5236:Plce1 UTSW 19 38770347 missense probably benign 0.11
R5268:Plce1 UTSW 19 38758835 missense possibly damaging 0.71
R5288:Plce1 UTSW 19 38760091 missense probably damaging 1.00
R5384:Plce1 UTSW 19 38760091 missense probably damaging 1.00
R5386:Plce1 UTSW 19 38760091 missense probably damaging 1.00
R5448:Plce1 UTSW 19 38779917 missense probably damaging 1.00
R5452:Plce1 UTSW 19 38620482 missense probably benign 0.01
R6004:Plce1 UTSW 19 38721871 missense probably damaging 1.00
R6062:Plce1 UTSW 19 38524751 missense probably benign
R6147:Plce1 UTSW 19 38702037 missense probably damaging 1.00
R6247:Plce1 UTSW 19 38745845 missense probably damaging 1.00
R6278:Plce1 UTSW 19 38725051 splice site probably null
R6306:Plce1 UTSW 19 38769465 missense probably damaging 1.00
R6317:Plce1 UTSW 19 38524530 nonsense probably null
R6437:Plce1 UTSW 19 38525132 missense probably benign 0.39
R6522:Plce1 UTSW 19 38748521 splice site probably null
R7034:Plce1 UTSW 19 38739357 missense probably damaging 1.00
R7036:Plce1 UTSW 19 38739357 missense probably damaging 1.00
R7037:Plce1 UTSW 19 38702017 missense probably damaging 1.00
R7069:Plce1 UTSW 19 38758940 missense probably damaging 1.00
R7180:Plce1 UTSW 19 38779785 missense probably damaging 1.00
R7189:Plce1 UTSW 19 38760137 missense probably damaging 0.97
R7227:Plce1 UTSW 19 38726902 missense probably benign 0.00
R7253:Plce1 UTSW 19 38698508 missense probably damaging 1.00
R7278:Plce1 UTSW 19 38779896 missense possibly damaging 0.58
R7287:Plce1 UTSW 19 38701903 missense probably benign 0.02
R7422:Plce1 UTSW 19 38651885 missense probably damaging 1.00
R7557:Plce1 UTSW 19 38765404 missense probably benign 0.30
R7607:Plce1 UTSW 19 38524752 missense probably benign
R7615:Plce1 UTSW 19 38524665 missense probably benign 0.18
R7653:Plce1 UTSW 19 38749319 missense probably benign 0.20
R7685:Plce1 UTSW 19 38748433 missense probably benign 0.00
R7716:Plce1 UTSW 19 38716851 missense probably benign
R7744:Plce1 UTSW 19 38620455 missense possibly damaging 0.93
R7790:Plce1 UTSW 19 38780696 missense probably damaging 0.97
R7921:Plce1 UTSW 19 38620553 missense probably benign 0.03
R8070:Plce1 UTSW 19 38701839 missense probably damaging 0.99
R8087:Plce1 UTSW 19 38736521 missense probably damaging 1.00
R8116:Plce1 UTSW 19 38524818 missense probably benign 0.32
R8178:Plce1 UTSW 19 38772979 missense possibly damaging 0.93
R8321:Plce1 UTSW 19 38651936 missense probably benign 0.00
R8416:Plce1 UTSW 19 38772997 missense possibly damaging 0.77
R8544:Plce1 UTSW 19 38524459 missense probably benign 0.00
R8713:Plce1 UTSW 19 38524901 missense probably benign 0.01
R8850:Plce1 UTSW 19 38524367 missense probably benign
R9217:Plce1 UTSW 19 38760107 missense probably damaging 1.00
R9231:Plce1 UTSW 19 38716596 missense probably benign 0.13
R9232:Plce1 UTSW 19 38716979 missense probably benign 0.16
R9332:Plce1 UTSW 19 38737933 missense probably damaging 1.00
R9473:Plce1 UTSW 19 38777893 missense possibly damaging 0.93
R9474:Plce1 UTSW 19 38777893 missense possibly damaging 0.93
R9476:Plce1 UTSW 19 38777893 missense possibly damaging 0.93
R9751:Plce1 UTSW 19 38728970 missense probably damaging 1.00
R9780:Plce1 UTSW 19 38620690 missense possibly damaging 0.94
R9781:Plce1 UTSW 19 38525210 missense probably damaging 1.00
RF018:Plce1 UTSW 19 38717207 missense probably damaging 0.99
X0022:Plce1 UTSW 19 38726999 missense probably damaging 1.00
X0065:Plce1 UTSW 19 38777914 missense possibly damaging 0.48
Z1176:Plce1 UTSW 19 38701894 missense probably damaging 1.00
Z1176:Plce1 UTSW 19 38724980 nonsense probably null
Z1176:Plce1 UTSW 19 38769460 missense probably damaging 1.00
Z1177:Plce1 UTSW 19 38651842 missense probably null 0.48
Predicted Primers PCR Primer
(F):5'- AGCAGGTTTATCTTTTCAGCAGG -3'
(R):5'- AGGGGAGATTCTCATGGTGC -3'

Sequencing Primer
(F):5'- CAGGGTGCATGCAAAAGATC -3'
(R):5'- ATTCTCATGGTGCTGGGAGCC -3'
Posted On 2022-06-15