Mutagenetix > Incidental Mutation

Incidental Mutation 'R9475:Ablim1'

715741

Institutional Source

Beutler Lab

Gene Symbol

Ablim1

Ensembl Gene

ENSMUSG00000025085

Gene Name

actin-binding LIM protein 1

Synonyms

2210411C18Rik, abLIM-L, abLIM-M, 4833406P10Rik, abLIM-S, 9330196J19Rik, 2610209L21Rik, Limab1

MMRRC Submission

Accession Numbers

Genbank: NM_178688; MGI: 1194500

Essential gene?

Possibly non essential (E-score: 0.315) question?

Stock #

R9475 (G1)

Quality Score

153.008

Status

Not validated

Chromosome

Chromosomal Location

57032733-57314919 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 57239180 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamine at position 18 (K18Q)

Ref Sequence

ENSEMBL: ENSMUSP00000107184 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111524] [ENSMUST00000111558] [ENSMUST00000111559]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000111524

SMART Domains

Protein: ENSMUSP00000107149
Gene: ENSMUSG00000025085

Domain	Start	End	E-Value	Type
LIM	21	72	1.14e-9	SMART
LIM	80	132	1.37e-12	SMART
LIM	148	199	1.12e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111558
AA Change: K18Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000107183
Gene: ENSMUSG00000025085
AA Change: K18Q

Domain	Start	End	E-Value	Type
LIM	35	86	1.14e-9	SMART
LIM	94	146	1.37e-12	SMART
LIM	162	213	1.12e-17	SMART
LIM	221	273	5.87e-12	SMART
low complexity region	325	334	N/A	INTRINSIC
low complexity region	498	503	N/A	INTRINSIC
coiled coil region	557	581	N/A	INTRINSIC
low complexity region	606	621	N/A	INTRINSIC
VHP	709	744	1.22e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111559
AA Change: K18Q

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000107184
Gene: ENSMUSG00000025085
AA Change: K18Q

Domain	Start	End	E-Value	Type
LIM	35	86	1.14e-9	SMART
LIM	94	146	1.37e-12	SMART
LIM	162	213	1.12e-17	SMART
LIM	221	273	5.87e-12	SMART
low complexity region	297	306	N/A	INTRINSIC
coiled coil region	527	551	N/A	INTRINSIC
low complexity region	576	591	N/A	INTRINSIC
VHP	679	714	1.22e-17	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal LIM protein that binds to actin filaments via a domain that is homologous to erythrocyte dematin. LIM domains, found in over 60 proteins, play key roles in the regulation of developmental pathways. LIM domains also function as protein-binding interfaces, mediating specific protein-protein interactions. The protein encoded by this gene could mediate such interactions between actin filaments and cytoplasmic targets. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice lacking the retina-specific isoform are healthy, fertile, and show no defects in retinal development or retinofugal projections. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(4)

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc6	A	T	7: 46,016,468	W243R	probably damaging	Het
Adamts18	T	A	8: 113,777,938	N174Y	possibly damaging	Het
Agbl2	A	G	2: 90,784,093	H23R	probably benign	Het
Akap6	T	G	12: 53,010,552	Y934D	probably damaging	Het
Alas1	C	T	9: 106,234,062	S635N	probably benign	Het
Ankrd24	A	G	10: 81,642,299		probably null	Het
Atp6v0a4	A	G	6: 38,060,982	L560P	probably damaging	Het
Cacng1	C	T	11: 107,716,292	V34M	possibly damaging	Het
Clcn3	C	T	8: 60,934,517	A233T	probably damaging	Het
Cntnap3	A	G	13: 64,799,135	F160S	probably damaging	Het
Ctnnd2	A	G	15: 30,881,130	S719G	probably damaging	Het
Exosc2	G	A	2: 31,674,743	V107I	probably benign	Het
Fam83b	C	A	9: 76,491,803	V673F	probably benign	Het
Fras1	T	C	5: 96,780,070	F3781L	probably damaging	Het
Gal3st1	T	A	11: 3,998,660	L289H	probably damaging	Het
Garem1	T	C	18: 21,148,313	I329V	probably benign	Het
Gli3	G	A	13: 15,725,711	G1228S	possibly damaging	Het
Gpbp1l1	T	C	4: 116,574,361	F72S	possibly damaging	Het
Hao1	T	A	2: 134,548,261	M53L	probably benign	Het
Hjurp	CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT	C	1: 88,266,277		probably benign	Het
Iqcm	A	G	8: 75,753,455	E347G	probably damaging	Het
Itpr3	G	A	17: 27,118,677		probably benign	Het
Kcnrg	A	G	14: 61,607,657	I49V	possibly damaging	Het
Lrrc8e	G	A	8: 4,235,346	G524S	probably benign	Het
Lrrn1	A	T	6: 107,568,300	Y353F	probably damaging	Het
Mdn1	A	G	4: 32,739,849	D3701G	possibly damaging	Het
Mtmr2	A	G	9: 13,805,471	T623A	probably benign	Het
Ndst4	C	A	3: 125,714,647	S287*	probably null	Het
Ntrk3	A	C	7: 78,302,732	M579R	probably benign	Het
Oas1a	G	A	5: 120,899,254	L237F	probably damaging	Het
Olfr1350	A	T	7: 6,570,819	Y276F	probably damaging	Het
Olfr169	T	C	16: 19,566,520	D121G	probably benign	Het
Olfr857	T	C	9: 19,713,643	M272T	probably benign	Het
Paqr5	T	A	9: 61,956,225	I272F	probably damaging	Het
Pcdha11	T	A	18: 37,007,538	V740E	probably damaging	Het
Pdgfra	A	C	5: 75,167,927	N240T	possibly damaging	Het
Plbd2	G	A	5: 120,494,380	Q186*	probably null	Het
Plce1	G	A	19: 38,777,893	E2121K	possibly damaging	Het
Ppargc1a	C	A	5: 51,495,738	G161C	probably damaging	Het
Ptprk	T	C	10: 28,334,480	I166T	possibly damaging	Het
Rhox8	GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT	GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT	X: 37,878,114		probably benign	Het
Rpap2	T	A	5: 107,620,589	L431Q	probably damaging	Het
Rslcan18	T	A	13: 67,102,064	K160*	probably null	Het
Sema7a	T	C	9: 57,954,905	F180L	probably benign	Het
Sh2d3c	C	T	2: 32,753,027	L741F	probably damaging	Het
Shank1	G	A	7: 44,312,918	S71N	unknown	Het
Skint6	C	T	4: 112,806,840		probably null	Het
Skiv2l	A	T	17: 34,841,102	D897E	probably benign	Het
Slc35f3	T	C	8: 126,382,254	S181P	probably damaging	Het
Slc4a9	A	T	18: 36,529,216	E127V	probably null	Het
Spata5	T	C	3: 37,431,909	V260A	probably benign	Het
Speg	C	T	1: 75,388,091	T372I	probably damaging	Het
Syce1l	A	G	8: 113,655,103	T204A	probably benign	Het
Tas2r138	T	A	6: 40,612,458	M285L	probably benign	Het
Tbc1d10a	G	C	11: 4,213,604	K285N	probably damaging	Het
Trim9	T	A	12: 70,346,454	M239L	probably benign	Het
Trp53bp1	A	G	2: 121,209,280	S1293P	probably benign	Het
Uaca	C	T	9: 60,872,216	T1295M	possibly damaging	Het
Ubald1	G	T	16: 4,875,569	Q161K	possibly damaging	Het
Ugt1a10	C	T	1: 88,216,260	R201C	probably damaging	Het
Vps45	T	G	3: 96,042,925	T231P	probably damaging	Het
Wdr17	A	T	8: 54,635,477	D1186E	probably benign	Het
Zfp534	G	A	4: 147,682,274	T8I	probably benign	Het
Zfp68	T	C	5: 138,607,255	N269D	probably benign	Het

Other mutations in Ablim1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00422:Ablim1	APN	19	57068186	missense	probably damaging	1.00
IGL00466:Ablim1	APN	19	57068186	missense	probably damaging	1.00
IGL00478:Ablim1	APN	19	57068186	missense	probably damaging	1.00
IGL00847:Ablim1	APN	19	57152290	missense	possibly damaging	0.59
IGL01063:Ablim1	APN	19	57061328	missense	probably damaging	1.00
IGL01304:Ablim1	APN	19	57215721	missense	probably benign
IGL01385:Ablim1	APN	19	57068914	missense	probably damaging	1.00
IGL01707:Ablim1	APN	19	57039447	missense	probably damaging	1.00
IGL02386:Ablim1	APN	19	57134654	missense	probably damaging	1.00
IGL02427:Ablim1	APN	19	57079880	splice site	probably benign
IGL02498:Ablim1	APN	19	57152319	nonsense	probably null
A9681:Ablim1	UTSW	19	57173323	critical splice donor site	probably null
R0089:Ablim1	UTSW	19	57043031	missense	probably damaging	1.00
R0226:Ablim1	UTSW	19	57043870	missense	probably damaging	1.00
R1419:Ablim1	UTSW	19	57134633	missense	probably damaging	1.00
R1473:Ablim1	UTSW	19	57068236	missense	probably damaging	1.00
R1587:Ablim1	UTSW	19	57083547	start codon destroyed	probably null	0.99
R1588:Ablim1	UTSW	19	57083547	start codon destroyed	probably null	0.99
R1935:Ablim1	UTSW	19	57215965	start gained	probably null
R1936:Ablim1	UTSW	19	57215965	start gained	probably null
R2021:Ablim1	UTSW	19	57047018	missense	probably damaging	0.98
R2110:Ablim1	UTSW	19	57043813	missense	possibly damaging	0.83
R2270:Ablim1	UTSW	19	57077431	missense	possibly damaging	0.58
R2509:Ablim1	UTSW	19	57152359	missense	probably damaging	1.00
R3621:Ablim1	UTSW	19	57152303	missense	probably damaging	0.97
R3732:Ablim1	UTSW	19	57049460	critical splice donor site	probably null
R3732:Ablim1	UTSW	19	57049460	critical splice donor site	probably null
R3733:Ablim1	UTSW	19	57049460	critical splice donor site	probably null
R3734:Ablim1	UTSW	19	57049460	critical splice donor site	probably null
R3878:Ablim1	UTSW	19	57037210	splice site	probably null
R4354:Ablim1	UTSW	19	57155278	missense	probably damaging	1.00
R4543:Ablim1	UTSW	19	57077442	missense	possibly damaging	0.87
R4749:Ablim1	UTSW	19	57215721	missense	probably benign
R4860:Ablim1	UTSW	19	57079866	missense	probably damaging	1.00
R4860:Ablim1	UTSW	19	57079866	missense	probably damaging	1.00
R5072:Ablim1	UTSW	19	57073853	critical splice donor site	probably null
R5277:Ablim1	UTSW	19	57155261	missense	probably damaging	1.00
R5331:Ablim1	UTSW	19	57155249	missense	probably damaging	1.00
R5354:Ablim1	UTSW	19	57130923	missense	probably benign	0.07
R5893:Ablim1	UTSW	19	57215853	missense	probably benign	0.07
R5958:Ablim1	UTSW	19	57041935	missense	probably damaging	1.00
R6435:Ablim1	UTSW	19	57061355	missense	possibly damaging	0.69
R6460:Ablim1	UTSW	19	57079839	missense	possibly damaging	0.96
R6642:Ablim1	UTSW	19	57130852	missense	probably benign	0.03
R6662:Ablim1	UTSW	19	57073853	critical splice donor site	probably null
R6705:Ablim1	UTSW	19	57215821	missense	probably benign	0.01
R7111:Ablim1	UTSW	19	57073877	missense	probably benign	0.05
R7291:Ablim1	UTSW	19	57215908	missense	probably benign
R7363:Ablim1	UTSW	19	57215741	missense	probably benign	0.10
R7901:Ablim1	UTSW	19	57131002	splice site	probably null
R7974:Ablim1	UTSW	19	57044973	critical splice acceptor site	probably null
R8079:Ablim1	UTSW	19	57182224	critical splice donor site	probably null
R8087:Ablim1	UTSW	19	57182256	missense
R8120:Ablim1	UTSW	19	57046928	missense	probably benign	0.00
R8277:Ablim1	UTSW	19	57215919	missense	probably benign	0.10
R8339:Ablim1	UTSW	19	57043849	missense	probably benign	0.00
R8536:Ablim1	UTSW	19	57182286	intron	probably benign
R8857:Ablim1	UTSW	19	57130855	missense	possibly damaging	0.84
R8875:Ablim1	UTSW	19	57130954	missense	probably benign	0.00
R8983:Ablim1	UTSW	19	57239212	missense	probably benign	0.02
R9055:Ablim1	UTSW	19	57041966	missense	probably benign	0.10
R9505:Ablim1	UTSW	19	57197350	intron	probably benign
R9695:Ablim1	UTSW	19	57182307	missense
R9762:Ablim1	UTSW	19	57037259	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACATGTGGGATAGGCACTTTATG -3'
(R):5'- AACTCACCGTTCTTCCTGGG -3'

Sequencing Primer
(F):5'- GGGATAGGCACTTTATGTAAGTATG -3'
(R):5'- TTCTTCCTGGGCCAGCAG -3'

Posted On

2022-06-15