Incidental Mutation 'R9476:Stk17b'
ID 715743
Institutional Source Beutler Lab
Gene Symbol Stk17b
Ensembl Gene ENSMUSG00000026094
Gene Name serine/threonine kinase 17b (apoptosis-inducing)
Synonyms 3110009A03Rik, Drak2
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.101) question?
Stock # R9476 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 53794671-53824374 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 53796898 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 290 (H290N)
Ref Sequence ENSEMBL: ENSMUSP00000027263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027263] [ENSMUST00000185920]
AlphaFold Q8BG48
Predicted Effect probably damaging
Transcript: ENSMUST00000027263
AA Change: H290N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027263
Gene: ENSMUSG00000026094
AA Change: H290N

DomainStartEndE-ValueType
S_TKc 33 293 5.77e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185920
SMART Domains Protein: ENSMUSP00000139880
Gene: ENSMUSG00000026094

DomainStartEndE-ValueType
S_TKc 1 93 5.8e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display abnormal T cell numbers, increased T cell proliferation, abnormal cytokine physiology, and decreased susceptibility to experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578G10Rik T G 4: 42,760,998 (GRCm39) W6G unknown Het
Aatk A T 11: 119,901,094 (GRCm39) C1101S probably benign Het
Abcb4 A T 5: 8,977,790 (GRCm39) D456V probably damaging Het
Abcc8 T C 7: 45,819,270 (GRCm39) E186G possibly damaging Het
Adam18 T C 8: 25,115,807 (GRCm39) N629S probably benign Het
Angpt2 T G 8: 18,764,143 (GRCm39) N133T probably benign Het
Ankrd13c T A 3: 157,697,396 (GRCm39) S334T probably benign Het
Ankrd13d A T 19: 4,320,289 (GRCm39) S151T unknown Het
Ap3d1 G A 10: 80,545,655 (GRCm39) P1025S probably benign Het
Bhlhe41 G A 6: 145,808,948 (GRCm39) A288V possibly damaging Het
Cacna1b T C 2: 24,540,058 (GRCm39) E1467G probably damaging Het
Cacna1h T A 17: 25,611,524 (GRCm39) T425S probably damaging Het
Cdk13 A C 13: 17,902,747 (GRCm39) C934W probably damaging Het
Ces1b T A 8: 93,799,890 (GRCm39) N162I probably damaging Het
Clec9a T A 6: 129,398,023 (GRCm39) I187K possibly damaging Het
Cpsf3 A G 12: 21,350,080 (GRCm39) I266M probably damaging Het
Cr2 G T 1: 194,840,416 (GRCm39) L509M probably damaging Het
Creb3l2 C A 6: 37,311,446 (GRCm39) G448W probably damaging Het
Csmd1 T A 8: 15,981,215 (GRCm39) probably null Het
Cul9 G A 17: 46,821,833 (GRCm39) R1881W probably damaging Het
Cyth1 C T 11: 118,076,206 (GRCm39) probably null Het
Dnhd1 A T 7: 105,352,889 (GRCm39) N2681Y possibly damaging Het
Dnm1 T C 2: 32,213,739 (GRCm39) M476V probably benign Het
Dnmt3a A G 12: 3,957,707 (GRCm39) H896R probably damaging Het
Dock1 T G 7: 134,592,279 (GRCm39) I938S probably benign Het
Dock6 G A 9: 21,724,821 (GRCm39) L1515F probably damaging Het
Dusp16 T C 6: 134,695,226 (GRCm39) H535R probably benign Het
Fancd2os T A 6: 113,574,994 (GRCm39) Y4F probably damaging Het
Fat4 A T 3: 39,037,886 (GRCm39) Q3846L probably benign Het
Fbxw10 A C 11: 62,743,814 (GRCm39) H240P probably benign Het
Frmd4a A G 2: 4,608,324 (GRCm39) T731A probably benign Het
Gm44501 T A 17: 40,889,820 (GRCm39) H111Q possibly damaging Het
Gsdmc T C 15: 63,650,551 (GRCm39) M277V probably benign Het
Hira A G 16: 18,772,789 (GRCm39) D867G probably damaging Het
Hmcn1 A G 1: 150,462,127 (GRCm39) S5184P probably benign Het
Ighv1-26 A C 12: 114,752,407 (GRCm39) F7V probably benign Het
Igkv4-81 C T 6: 68,967,796 (GRCm39) E102K possibly damaging Het
Inmt G T 6: 55,147,990 (GRCm39) S213Y possibly damaging Het
Ints2 T A 11: 86,135,335 (GRCm39) M360L probably benign Het
Itih3 A G 14: 30,631,416 (GRCm39) S827P probably benign Het
Itpr3 G A 17: 27,337,651 (GRCm39) probably benign Het
Kcnk12 C A 17: 88,054,122 (GRCm39) R180L probably benign Het
Kndc1 G A 7: 139,510,031 (GRCm39) S1291N probably benign Het
Mettl21a T C 1: 64,647,285 (GRCm39) T91A probably damaging Het
Mmrn2 A G 14: 34,120,407 (GRCm39) I426V possibly damaging Het
Mrpl21 T G 19: 3,337,704 (GRCm39) V137G probably damaging Het
Nrbp2 T C 15: 75,961,626 (GRCm39) N218S probably damaging Het
Nrip1 T C 16: 76,089,820 (GRCm39) N579S probably benign Het
Nsf T C 11: 103,763,988 (GRCm39) N365S probably damaging Het
Or6c5 A G 10: 129,074,656 (GRCm39) I213V probably damaging Het
Or7g28 A T 9: 19,272,383 (GRCm39) D89E probably benign Het
Osbpl3 C T 6: 50,313,194 (GRCm39) probably null Het
Oscar T A 7: 3,614,843 (GRCm39) H43L probably benign Het
Pam C T 1: 97,826,065 (GRCm39) probably null Het
Parn A T 16: 13,358,942 (GRCm39) M600K probably benign Het
Pcdha11 C A 18: 37,139,532 (GRCm39) T387N probably benign Het
Plce1 G A 19: 38,766,337 (GRCm39) E2121K possibly damaging Het
Prune2 T A 19: 17,096,706 (GRCm39) Y737N possibly damaging Het
Ptch1 G A 13: 63,681,448 (GRCm39) P613L probably benign Het
Ptprt A C 2: 161,397,381 (GRCm39) C1129G probably damaging Het
Rara C T 11: 98,860,983 (GRCm39) S157L probably benign Het
Rest T A 5: 77,416,098 (GRCm39) M104K probably damaging Het
Rfc1 A G 5: 65,437,142 (GRCm39) S513P probably damaging Het
Rnf40 T A 7: 127,201,808 (GRCm39) I1000N probably damaging Het
Scube2 C T 7: 109,430,969 (GRCm39) G410E probably damaging Het
Sh3gl2 A G 4: 85,304,089 (GRCm39) E264G probably benign Het
Shank1 G A 7: 43,962,342 (GRCm39) S71N unknown Het
Smc4 T G 3: 68,914,662 (GRCm39) S92A probably damaging Het
Spata31d1b A G 13: 59,863,467 (GRCm39) D205G probably benign Het
Spata31e4 A G 13: 50,856,149 (GRCm39) T596A possibly damaging Het
Spef2 T C 15: 9,713,203 (GRCm39) R390G probably damaging Het
Speg T C 1: 75,377,768 (GRCm39) F842S probably damaging Het
Stpg3 A T 2: 25,103,516 (GRCm39) V191D probably benign Het
Supt6 C T 11: 78,120,290 (GRCm39) R350H probably damaging Het
Tet3 T C 6: 83,380,935 (GRCm39) E411G possibly damaging Het
Tet3 T A 6: 83,381,808 (GRCm39) probably null Het
Tns3 A G 11: 8,395,702 (GRCm39) I1234T probably damaging Het
Trim34b A G 7: 103,980,503 (GRCm39) E197G probably damaging Het
Vcan G T 13: 89,851,531 (GRCm39) T1143K possibly damaging Het
Vmn2r61 T A 7: 41,949,593 (GRCm39) V671E probably damaging Het
Wdtc1 A G 4: 133,049,529 (GRCm39) V29A probably damaging Het
Zfp462 G A 4: 55,080,735 (GRCm39) M2450I probably benign Het
Zfp869 A T 8: 70,159,849 (GRCm39) C241* probably null Het
Other mutations in Stk17b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00722:Stk17b APN 1 53,803,299 (GRCm39) missense probably damaging 0.99
IGL00767:Stk17b APN 1 53,803,182 (GRCm39) splice site probably benign
IGL01012:Stk17b APN 1 53,800,196 (GRCm39) missense probably benign 0.06
IGL01431:Stk17b APN 1 53,805,074 (GRCm39) splice site probably benign
IGL01914:Stk17b APN 1 53,800,226 (GRCm39) missense probably damaging 0.98
IGL02236:Stk17b APN 1 53,803,247 (GRCm39) missense probably damaging 1.00
IGL02827:Stk17b APN 1 53,815,701 (GRCm39) missense probably benign 0.03
R0013:Stk17b UTSW 1 53,803,291 (GRCm39) missense probably benign 0.36
R0545:Stk17b UTSW 1 53,801,742 (GRCm39) splice site probably benign
R0831:Stk17b UTSW 1 53,796,651 (GRCm39) missense probably damaging 1.00
R1035:Stk17b UTSW 1 53,801,758 (GRCm39) missense probably benign 0.22
R1375:Stk17b UTSW 1 53,805,106 (GRCm39) missense possibly damaging 0.83
R1576:Stk17b UTSW 1 53,796,749 (GRCm39) missense probably damaging 1.00
R1809:Stk17b UTSW 1 53,805,140 (GRCm39) missense possibly damaging 0.80
R1988:Stk17b UTSW 1 53,800,241 (GRCm39) missense probably damaging 1.00
R2033:Stk17b UTSW 1 53,800,235 (GRCm39) missense probably damaging 1.00
R2105:Stk17b UTSW 1 53,815,764 (GRCm39) missense probably benign 0.01
R2255:Stk17b UTSW 1 53,815,731 (GRCm39) missense probably benign 0.00
R4395:Stk17b UTSW 1 53,803,274 (GRCm39) missense probably damaging 0.98
R4521:Stk17b UTSW 1 53,803,197 (GRCm39) missense probably damaging 1.00
R4777:Stk17b UTSW 1 53,810,867 (GRCm39) missense probably damaging 1.00
R4871:Stk17b UTSW 1 53,796,693 (GRCm39) missense probably benign 0.14
R4892:Stk17b UTSW 1 53,810,770 (GRCm39) missense probably damaging 0.99
R4999:Stk17b UTSW 1 53,800,306 (GRCm39) splice site probably null
R5122:Stk17b UTSW 1 53,815,717 (GRCm39) missense probably damaging 1.00
R5621:Stk17b UTSW 1 53,810,943 (GRCm39) nonsense probably null
R6636:Stk17b UTSW 1 53,800,247 (GRCm39) missense probably damaging 1.00
R6924:Stk17b UTSW 1 53,800,218 (GRCm39) missense possibly damaging 0.54
R7283:Stk17b UTSW 1 53,796,674 (GRCm39) missense probably benign
R7322:Stk17b UTSW 1 53,805,104 (GRCm39) missense probably benign 0.16
R7671:Stk17b UTSW 1 53,805,159 (GRCm39) missense probably damaging 0.99
R8984:Stk17b UTSW 1 53,796,784 (GRCm39) missense probably benign 0.05
R9510:Stk17b UTSW 1 53,796,898 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGCAAGGAGTCATCGAATC -3'
(R):5'- GAAATAGCCCTGCCGTATACATAAG -3'

Sequencing Primer
(F):5'- ACTAAGCTGCCATCTTCAGGGATG -3'
(R):5'- TGGAAGACATGCTCAGCT -3'
Posted On 2022-06-15