Incidental Mutation 'R9476:Cr2'
ID 715748
Institutional Source Beutler Lab
Gene Symbol Cr2
Ensembl Gene ENSMUSG00000026616
Gene Name complement receptor 2
Synonyms C3DR, CD21, Cr-2, Cr1, Cr-1, CD35
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.142) question?
Stock # R9476 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 194819119-194859024 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 194840416 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Methionine at position 509 (L509M)
Ref Sequence ENSEMBL: ENSMUSP00000080938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082321] [ENSMUST00000193356] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000082321
AA Change: L509M

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616
AA Change: L509M

DomainStartEndE-ValueType
CCP 23 82 1.01e-11 SMART
CCP 91 147 9.1e-14 SMART
CCP 155 211 1.9e-16 SMART
CCP 216 272 1.6e-9 SMART
CCP 277 343 1.01e-11 SMART
CCP 352 407 1.2e-13 SMART
CCP 411 467 2.34e-16 SMART
CCP 472 523 1.24e0 SMART
CCP 528 594 4.48e-13 SMART
CCP 603 658 1.95e-13 SMART
CCP 718 778 1.75e-15 SMART
CCP 787 842 2.06e-12 SMART
CCP 850 906 7.92e-14 SMART
CCP 911 967 1.29e-13 SMART
transmembrane domain 975 997 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000193356
AA Change: L212M

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141706
Gene: ENSMUSG00000026616
AA Change: L212M

DomainStartEndE-ValueType
CCP 1 46 1.2e-1 SMART
CCP 55 110 5.9e-16 SMART
CCP 114 170 1.1e-18 SMART
CCP 175 226 6.1e-3 SMART
CCP 231 297 2.2e-15 SMART
CCP 306 361 9.4e-16 SMART
CCP 421 481 8.3e-18 SMART
CCP 490 545 1e-14 SMART
CCP 553 609 4e-16 SMART
CCP 614 670 6.2e-16 SMART
transmembrane domain 678 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193801
SMART Domains Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000195120
AA Change: L509M

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616
AA Change: L509M

DomainStartEndE-ValueType
CCP 23 82 4.9e-14 SMART
CCP 91 147 4.5e-16 SMART
CCP 155 211 9.1e-19 SMART
CCP 216 272 8e-12 SMART
CCP 277 343 5e-14 SMART
CCP 352 407 5.9e-16 SMART
CCP 411 467 1.1e-18 SMART
CCP 472 523 6.1e-3 SMART
CCP 528 594 2.2e-15 SMART
CCP 603 658 9.4e-16 SMART
CCP 718 778 8.3e-18 SMART
CCP 787 842 1e-14 SMART
CCP 850 906 4e-16 SMART
CCP 911 967 6.2e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000210219
AA Change: L885M

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578G10Rik T G 4: 42,760,998 (GRCm39) W6G unknown Het
Aatk A T 11: 119,901,094 (GRCm39) C1101S probably benign Het
Abcb4 A T 5: 8,977,790 (GRCm39) D456V probably damaging Het
Abcc8 T C 7: 45,819,270 (GRCm39) E186G possibly damaging Het
Adam18 T C 8: 25,115,807 (GRCm39) N629S probably benign Het
Angpt2 T G 8: 18,764,143 (GRCm39) N133T probably benign Het
Ankrd13c T A 3: 157,697,396 (GRCm39) S334T probably benign Het
Ankrd13d A T 19: 4,320,289 (GRCm39) S151T unknown Het
Ap3d1 G A 10: 80,545,655 (GRCm39) P1025S probably benign Het
Bhlhe41 G A 6: 145,808,948 (GRCm39) A288V possibly damaging Het
Cacna1b T C 2: 24,540,058 (GRCm39) E1467G probably damaging Het
Cacna1h T A 17: 25,611,524 (GRCm39) T425S probably damaging Het
Cdk13 A C 13: 17,902,747 (GRCm39) C934W probably damaging Het
Ces1b T A 8: 93,799,890 (GRCm39) N162I probably damaging Het
Clec9a T A 6: 129,398,023 (GRCm39) I187K possibly damaging Het
Cpsf3 A G 12: 21,350,080 (GRCm39) I266M probably damaging Het
Creb3l2 C A 6: 37,311,446 (GRCm39) G448W probably damaging Het
Csmd1 T A 8: 15,981,215 (GRCm39) probably null Het
Cul9 G A 17: 46,821,833 (GRCm39) R1881W probably damaging Het
Cyth1 C T 11: 118,076,206 (GRCm39) probably null Het
Dnhd1 A T 7: 105,352,889 (GRCm39) N2681Y possibly damaging Het
Dnm1 T C 2: 32,213,739 (GRCm39) M476V probably benign Het
Dnmt3a A G 12: 3,957,707 (GRCm39) H896R probably damaging Het
Dock1 T G 7: 134,592,279 (GRCm39) I938S probably benign Het
Dock6 G A 9: 21,724,821 (GRCm39) L1515F probably damaging Het
Dusp16 T C 6: 134,695,226 (GRCm39) H535R probably benign Het
Fancd2os T A 6: 113,574,994 (GRCm39) Y4F probably damaging Het
Fat4 A T 3: 39,037,886 (GRCm39) Q3846L probably benign Het
Fbxw10 A C 11: 62,743,814 (GRCm39) H240P probably benign Het
Frmd4a A G 2: 4,608,324 (GRCm39) T731A probably benign Het
Gm44501 T A 17: 40,889,820 (GRCm39) H111Q possibly damaging Het
Gsdmc T C 15: 63,650,551 (GRCm39) M277V probably benign Het
Hira A G 16: 18,772,789 (GRCm39) D867G probably damaging Het
Hmcn1 A G 1: 150,462,127 (GRCm39) S5184P probably benign Het
Ighv1-26 A C 12: 114,752,407 (GRCm39) F7V probably benign Het
Igkv4-81 C T 6: 68,967,796 (GRCm39) E102K possibly damaging Het
Inmt G T 6: 55,147,990 (GRCm39) S213Y possibly damaging Het
Ints2 T A 11: 86,135,335 (GRCm39) M360L probably benign Het
Itih3 A G 14: 30,631,416 (GRCm39) S827P probably benign Het
Itpr3 G A 17: 27,337,651 (GRCm39) probably benign Het
Kcnk12 C A 17: 88,054,122 (GRCm39) R180L probably benign Het
Kndc1 G A 7: 139,510,031 (GRCm39) S1291N probably benign Het
Mettl21a T C 1: 64,647,285 (GRCm39) T91A probably damaging Het
Mmrn2 A G 14: 34,120,407 (GRCm39) I426V possibly damaging Het
Mrpl21 T G 19: 3,337,704 (GRCm39) V137G probably damaging Het
Nrbp2 T C 15: 75,961,626 (GRCm39) N218S probably damaging Het
Nrip1 T C 16: 76,089,820 (GRCm39) N579S probably benign Het
Nsf T C 11: 103,763,988 (GRCm39) N365S probably damaging Het
Or6c5 A G 10: 129,074,656 (GRCm39) I213V probably damaging Het
Or7g28 A T 9: 19,272,383 (GRCm39) D89E probably benign Het
Osbpl3 C T 6: 50,313,194 (GRCm39) probably null Het
Oscar T A 7: 3,614,843 (GRCm39) H43L probably benign Het
Pam C T 1: 97,826,065 (GRCm39) probably null Het
Parn A T 16: 13,358,942 (GRCm39) M600K probably benign Het
Pcdha11 C A 18: 37,139,532 (GRCm39) T387N probably benign Het
Plce1 G A 19: 38,766,337 (GRCm39) E2121K possibly damaging Het
Prune2 T A 19: 17,096,706 (GRCm39) Y737N possibly damaging Het
Ptch1 G A 13: 63,681,448 (GRCm39) P613L probably benign Het
Ptprt A C 2: 161,397,381 (GRCm39) C1129G probably damaging Het
Rara C T 11: 98,860,983 (GRCm39) S157L probably benign Het
Rest T A 5: 77,416,098 (GRCm39) M104K probably damaging Het
Rfc1 A G 5: 65,437,142 (GRCm39) S513P probably damaging Het
Rnf40 T A 7: 127,201,808 (GRCm39) I1000N probably damaging Het
Scube2 C T 7: 109,430,969 (GRCm39) G410E probably damaging Het
Sh3gl2 A G 4: 85,304,089 (GRCm39) E264G probably benign Het
Shank1 G A 7: 43,962,342 (GRCm39) S71N unknown Het
Smc4 T G 3: 68,914,662 (GRCm39) S92A probably damaging Het
Spata31d1b A G 13: 59,863,467 (GRCm39) D205G probably benign Het
Spata31e4 A G 13: 50,856,149 (GRCm39) T596A possibly damaging Het
Spef2 T C 15: 9,713,203 (GRCm39) R390G probably damaging Het
Speg T C 1: 75,377,768 (GRCm39) F842S probably damaging Het
Stk17b G T 1: 53,796,898 (GRCm39) H290N probably damaging Het
Stpg3 A T 2: 25,103,516 (GRCm39) V191D probably benign Het
Supt6 C T 11: 78,120,290 (GRCm39) R350H probably damaging Het
Tet3 T C 6: 83,380,935 (GRCm39) E411G possibly damaging Het
Tet3 T A 6: 83,381,808 (GRCm39) probably null Het
Tns3 A G 11: 8,395,702 (GRCm39) I1234T probably damaging Het
Trim34b A G 7: 103,980,503 (GRCm39) E197G probably damaging Het
Vcan G T 13: 89,851,531 (GRCm39) T1143K possibly damaging Het
Vmn2r61 T A 7: 41,949,593 (GRCm39) V671E probably damaging Het
Wdtc1 A G 4: 133,049,529 (GRCm39) V29A probably damaging Het
Zfp462 G A 4: 55,080,735 (GRCm39) M2450I probably benign Het
Zfp869 A T 8: 70,159,849 (GRCm39) C241* probably null Het
Other mutations in Cr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Cr2 APN 1 194,836,559 (GRCm39) missense possibly damaging 0.76
IGL01326:Cr2 APN 1 194,823,529 (GRCm39) missense probably null 1.00
IGL01358:Cr2 APN 1 194,842,128 (GRCm39) missense probably damaging 1.00
IGL01410:Cr2 APN 1 194,845,542 (GRCm39) missense possibly damaging 0.49
IGL01468:Cr2 APN 1 194,850,843 (GRCm39) missense probably damaging 1.00
IGL01608:Cr2 APN 1 194,837,528 (GRCm39) missense possibly damaging 0.50
IGL01810:Cr2 APN 1 194,841,903 (GRCm39) missense possibly damaging 0.49
IGL01843:Cr2 APN 1 194,833,222 (GRCm39) splice site probably benign
IGL02332:Cr2 APN 1 194,842,630 (GRCm39) missense probably benign 0.19
IGL02934:Cr2 APN 1 194,836,633 (GRCm39) splice site probably benign
IGL02938:Cr2 APN 1 194,848,696 (GRCm39) missense probably damaging 1.00
IGL03149:Cr2 APN 1 194,848,674 (GRCm39) missense probably damaging 1.00
IGL03327:Cr2 APN 1 194,852,067 (GRCm39) missense probably damaging 1.00
IGL03346:Cr2 APN 1 194,852,067 (GRCm39) missense probably damaging 1.00
Pillar UTSW 1 194,838,196 (GRCm39) nonsense probably null
PIT4354001:Cr2 UTSW 1 194,848,617 (GRCm39) missense probably damaging 1.00
PIT4418001:Cr2 UTSW 1 194,839,760 (GRCm39) missense probably benign 0.08
R0128:Cr2 UTSW 1 194,848,539 (GRCm39) missense probably damaging 0.99
R0130:Cr2 UTSW 1 194,848,539 (GRCm39) missense probably damaging 0.99
R0380:Cr2 UTSW 1 194,839,715 (GRCm39) missense probably damaging 1.00
R0538:Cr2 UTSW 1 194,842,667 (GRCm39) splice site probably benign
R0605:Cr2 UTSW 1 194,845,904 (GRCm39) splice site probably benign
R0626:Cr2 UTSW 1 194,853,419 (GRCm39) missense possibly damaging 0.95
R1135:Cr2 UTSW 1 194,839,498 (GRCm39) missense probably damaging 1.00
R1396:Cr2 UTSW 1 194,851,561 (GRCm39) splice site probably null
R1422:Cr2 UTSW 1 194,853,433 (GRCm39) missense probably benign 0.01
R1467:Cr2 UTSW 1 194,839,817 (GRCm39) missense probably damaging 1.00
R1467:Cr2 UTSW 1 194,839,817 (GRCm39) missense probably damaging 1.00
R1511:Cr2 UTSW 1 194,837,580 (GRCm39) missense possibly damaging 0.92
R1572:Cr2 UTSW 1 194,845,622 (GRCm39) missense probably damaging 1.00
R1714:Cr2 UTSW 1 194,833,994 (GRCm39) missense possibly damaging 0.46
R1748:Cr2 UTSW 1 194,838,213 (GRCm39) nonsense probably null
R1761:Cr2 UTSW 1 194,837,431 (GRCm39) critical splice donor site probably null
R1824:Cr2 UTSW 1 194,839,624 (GRCm39) missense probably damaging 1.00
R1893:Cr2 UTSW 1 194,837,495 (GRCm39) missense probably benign 0.03
R1990:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R1991:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R1992:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R2191:Cr2 UTSW 1 194,845,689 (GRCm39) missense possibly damaging 0.94
R2276:Cr2 UTSW 1 194,839,676 (GRCm39) missense possibly damaging 0.94
R2277:Cr2 UTSW 1 194,839,676 (GRCm39) missense possibly damaging 0.94
R3548:Cr2 UTSW 1 194,838,196 (GRCm39) nonsense probably null
R3743:Cr2 UTSW 1 194,832,274 (GRCm39) splice site probably benign
R3941:Cr2 UTSW 1 194,848,122 (GRCm39) missense probably damaging 0.97
R3963:Cr2 UTSW 1 194,842,047 (GRCm39) missense probably damaging 1.00
R4211:Cr2 UTSW 1 194,838,636 (GRCm39) missense probably damaging 0.96
R4484:Cr2 UTSW 1 194,836,482 (GRCm39) missense probably damaging 1.00
R4546:Cr2 UTSW 1 194,853,349 (GRCm39) missense possibly damaging 0.94
R4791:Cr2 UTSW 1 194,838,243 (GRCm39) missense probably damaging 1.00
R4801:Cr2 UTSW 1 194,845,619 (GRCm39) missense probably damaging 1.00
R4802:Cr2 UTSW 1 194,845,619 (GRCm39) missense probably damaging 1.00
R4874:Cr2 UTSW 1 194,858,878 (GRCm39) missense possibly damaging 0.82
R4885:Cr2 UTSW 1 194,841,039 (GRCm39) missense possibly damaging 0.92
R4889:Cr2 UTSW 1 194,858,893 (GRCm39) missense possibly damaging 0.70
R5154:Cr2 UTSW 1 194,841,754 (GRCm39) missense probably damaging 1.00
R5574:Cr2 UTSW 1 194,823,544 (GRCm39) missense probably damaging 1.00
R5594:Cr2 UTSW 1 194,839,498 (GRCm39) missense probably damaging 1.00
R5645:Cr2 UTSW 1 194,836,581 (GRCm39) missense probably damaging 1.00
R5700:Cr2 UTSW 1 194,842,065 (GRCm39) missense probably damaging 0.96
R5929:Cr2 UTSW 1 194,853,419 (GRCm39) missense possibly damaging 0.91
R6237:Cr2 UTSW 1 194,839,810 (GRCm39) missense probably damaging 1.00
R6299:Cr2 UTSW 1 194,850,954 (GRCm39) missense probably damaging 1.00
R6368:Cr2 UTSW 1 194,850,780 (GRCm39) missense probably damaging 1.00
R6406:Cr2 UTSW 1 194,852,079 (GRCm39) missense probably damaging 1.00
R6618:Cr2 UTSW 1 194,839,687 (GRCm39) missense probably damaging 0.98
R6684:Cr2 UTSW 1 194,853,329 (GRCm39) nonsense probably null
R6720:Cr2 UTSW 1 194,837,508 (GRCm39) missense probably damaging 0.97
R6866:Cr2 UTSW 1 194,833,999 (GRCm39) missense probably damaging 1.00
R6915:Cr2 UTSW 1 194,853,454 (GRCm39) missense probably benign 0.06
R7057:Cr2 UTSW 1 194,833,918 (GRCm39) missense possibly damaging 0.83
R7117:Cr2 UTSW 1 194,842,909 (GRCm39) missense possibly damaging 0.79
R7200:Cr2 UTSW 1 194,845,557 (GRCm39) missense probably damaging 1.00
R7209:Cr2 UTSW 1 194,851,032 (GRCm39) missense probably damaging 1.00
R7350:Cr2 UTSW 1 194,837,594 (GRCm39) missense probably benign 0.21
R7414:Cr2 UTSW 1 194,832,344 (GRCm39) missense probably benign
R7453:Cr2 UTSW 1 194,847,565 (GRCm39) splice site probably null
R7479:Cr2 UTSW 1 194,840,718 (GRCm39) critical splice donor site probably null
R7480:Cr2 UTSW 1 194,836,484 (GRCm39) missense probably damaging 1.00
R7570:Cr2 UTSW 1 194,851,648 (GRCm39) nonsense probably null
R7666:Cr2 UTSW 1 194,836,533 (GRCm39) missense probably damaging 1.00
R7921:Cr2 UTSW 1 194,833,975 (GRCm39) missense possibly damaging 0.94
R7923:Cr2 UTSW 1 194,850,995 (GRCm39) missense probably benign 0.03
R8396:Cr2 UTSW 1 194,840,376 (GRCm39) missense probably damaging 1.00
R8503:Cr2 UTSW 1 194,845,850 (GRCm39) missense probably benign
R8517:Cr2 UTSW 1 194,838,207 (GRCm39) missense probably benign 0.03
R8773:Cr2 UTSW 1 194,840,913 (GRCm39) missense probably damaging 1.00
R8849:Cr2 UTSW 1 194,839,547 (GRCm39) missense probably damaging 1.00
R8896:Cr2 UTSW 1 194,851,581 (GRCm39) missense possibly damaging 0.58
R8938:Cr2 UTSW 1 194,853,424 (GRCm39) missense probably damaging 0.99
R9027:Cr2 UTSW 1 194,834,029 (GRCm39) missense probably benign 0.08
R9045:Cr2 UTSW 1 194,837,680 (GRCm39) missense possibly damaging 0.61
R9116:Cr2 UTSW 1 194,840,977 (GRCm39) nonsense probably null
R9137:Cr2 UTSW 1 194,850,640 (GRCm39) critical splice donor site probably null
R9497:Cr2 UTSW 1 194,850,743 (GRCm39) missense probably damaging 0.99
R9510:Cr2 UTSW 1 194,840,416 (GRCm39) missense probably damaging 0.97
R9752:Cr2 UTSW 1 194,823,575 (GRCm39) missense probably benign 0.37
R9799:Cr2 UTSW 1 194,842,988 (GRCm39) missense probably benign 0.02
X0028:Cr2 UTSW 1 194,832,290 (GRCm39) missense probably benign 0.09
X0066:Cr2 UTSW 1 194,848,629 (GRCm39) missense probably damaging 0.99
Z1176:Cr2 UTSW 1 194,836,461 (GRCm39) missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TTGACGCAACCCAAAGTAGG -3'
(R):5'- CTATGCAGTTAATGGATGGTGC -3'

Sequencing Primer
(F):5'- CCCAAAGTAGGAATTTTGGCTCC -3'
(R):5'- CAGTTAATGGATGGTGCTGAGG -3'
Posted On 2022-06-15