Mutagenetix > Incidental Mutation

Incidental Mutation 'R9476:Cr2'

715748

Institutional Source

Beutler Lab

Gene Symbol

Cr2

Ensembl Gene

ENSMUSG00000026616

Gene Name

complement receptor 2

Synonyms

C3DR, CD21, Cr-1, Cr1, CD35, Cr-2

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.125) question?

Stock #

R9476 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

195136811-195176716 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 195158108 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Methionine at position 509 (L509M)

Ref Sequence

ENSEMBL: ENSMUSP00000080938 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082321] [ENSMUST00000193356] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000082321
AA Change: L509M

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616
AA Change: L509M

Domain	Start	End	E-Value	Type
CCP	23	82	1.01e-11	SMART
CCP	91	147	9.1e-14	SMART
CCP	155	211	1.9e-16	SMART
CCP	216	272	1.6e-9	SMART
CCP	277	343	1.01e-11	SMART
CCP	352	407	1.2e-13	SMART
CCP	411	467	2.34e-16	SMART
CCP	472	523	1.24e0	SMART
CCP	528	594	4.48e-13	SMART
CCP	603	658	1.95e-13	SMART
CCP	718	778	1.75e-15	SMART
CCP	787	842	2.06e-12	SMART
CCP	850	906	7.92e-14	SMART
CCP	911	967	1.29e-13	SMART
transmembrane domain	975	997	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000193356
AA Change: L212M

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000141706
Gene: ENSMUSG00000026616
AA Change: L212M

Domain	Start	End	E-Value	Type
CCP	1	46	1.2e-1	SMART
CCP	55	110	5.9e-16	SMART
CCP	114	170	1.1e-18	SMART
CCP	175	226	6.1e-3	SMART
CCP	231	297	2.2e-15	SMART
CCP	306	361	9.4e-16	SMART
CCP	421	481	8.3e-18	SMART
CCP	490	545	1e-14	SMART
CCP	553	609	4e-16	SMART
CCP	614	670	6.2e-16	SMART
transmembrane domain	678	700	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193801

SMART Domains

Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000195120
AA Change: L509M

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616
AA Change: L509M

Domain	Start	End	E-Value	Type
CCP	23	82	4.9e-14	SMART
CCP	91	147	4.5e-16	SMART
CCP	155	211	9.1e-19	SMART
CCP	216	272	8e-12	SMART
CCP	277	343	5e-14	SMART
CCP	352	407	5.9e-16	SMART
CCP	411	467	1.1e-18	SMART
CCP	472	523	6.1e-3	SMART
CCP	528	594	2.2e-15	SMART
CCP	603	658	9.4e-16	SMART
CCP	718	778	8.3e-18	SMART
CCP	787	842	1e-14	SMART
CCP	850	906	4e-16	SMART
CCP	911	967	6.2e-16	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000210219
AA Change: L885M

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930578G10Rik	T	G	4: 42,760,998	W6G	unknown	Het
Aatk	A	T	11: 120,010,268	C1101S	probably benign	Het
Abcb4	A	T	5: 8,927,790	D456V	probably damaging	Het
Abcc8	T	C	7: 46,169,846	E186G	possibly damaging	Het
Adam18	T	C	8: 24,625,791	N629S	probably benign	Het
Angpt2	T	G	8: 18,714,127	N133T	probably benign	Het
Ankrd13c	T	A	3: 157,991,759	S334T	probably benign	Het
Ankrd13d	A	T	19: 4,270,261	S151T	unknown	Het
Ap3d1	G	A	10: 80,709,821	P1025S	probably benign	Het
Bhlhe41	G	A	6: 145,863,222	A288V	possibly damaging	Het
Cacna1b	T	C	2: 24,650,046	E1467G	probably damaging	Het
Cacna1h	T	A	17: 25,392,550	T425S	probably damaging	Het
Cdk13	A	C	13: 17,728,162	C934W	probably damaging	Het
Ces1b	T	A	8: 93,073,262	N162I	probably damaging	Het
Clec9a	T	A	6: 129,421,060	I187K	possibly damaging	Het
Cpsf3	A	G	12: 21,300,079	I266M	probably damaging	Het
Creb3l2	C	A	6: 37,334,511	G448W	probably damaging	Het
Csmd1	T	A	8: 15,931,215		probably null	Het
Cul9	G	A	17: 46,510,907	R1881W	probably damaging	Het
Cyth1	C	T	11: 118,185,380		probably null	Het
Dnhd1	A	T	7: 105,703,682	N2681Y	possibly damaging	Het
Dnm1	T	C	2: 32,323,727	M476V	probably benign	Het
Dnmt3a	A	G	12: 3,907,707	H896R	probably damaging	Het
Dock1	T	G	7: 134,990,550	I938S	probably benign	Het
Dock6	G	A	9: 21,813,525	L1515F	probably damaging	Het
Dusp16	T	C	6: 134,718,263	H535R	probably benign	Het
Fancd2os	T	A	6: 113,598,033	Y4F	probably damaging	Het
Fat4	A	T	3: 38,983,737	Q3846L	probably benign	Het
Fbxw10	A	C	11: 62,852,988	H240P	probably benign	Het
Frmd4a	A	G	2: 4,603,513	T731A	probably benign	Het
Gm44501	T	A	17: 40,578,929	H111Q	possibly damaging	Het
Gm8765	A	G	13: 50,702,113	T596A	possibly damaging	Het
Gsdmc	T	C	15: 63,778,702	M277V	probably benign	Het
Hira	A	G	16: 18,954,039	D867G	probably damaging	Het
Hmcn1	A	G	1: 150,586,376	S5184P	probably benign	Het
Ighv1-26	A	C	12: 114,788,787	F7V	probably benign	Het
Igkv4-81	C	T	6: 68,990,812	E102K	possibly damaging	Het
Inmt	G	T	6: 55,171,005	S213Y	possibly damaging	Het
Ints2	T	A	11: 86,244,509	M360L	probably benign	Het
Itih3	A	G	14: 30,909,459	S827P	probably benign	Het
Itpr3	G	A	17: 27,118,677		probably benign	Het
Kcnk12	C	A	17: 87,746,694	R180L	probably benign	Het
Kndc1	G	A	7: 139,930,118	S1291N	probably benign	Het
Mettl21a	T	C	1: 64,608,126	T91A	probably damaging	Het
Mmrn2	A	G	14: 34,398,450	I426V	possibly damaging	Het
Mrpl21	T	G	19: 3,287,704	V137G	probably damaging	Het
Nrbp2	T	C	15: 76,089,777	N218S	probably damaging	Het
Nrip1	T	C	16: 76,292,932	N579S	probably benign	Het
Nsf	T	C	11: 103,873,162	N365S	probably damaging	Het
Olfr774	A	G	10: 129,238,787	I213V	probably damaging	Het
Olfr846	A	T	9: 19,361,087	D89E	probably benign	Het
Osbpl3	C	T	6: 50,336,214		probably null	Het
Oscar	T	A	7: 3,611,844	H43L	probably benign	Het
Pam	C	T	1: 97,898,340		probably null	Het
Parn	A	T	16: 13,541,078	M600K	probably benign	Het
Pcdha11	C	A	18: 37,006,479	T387N	probably benign	Het
Plce1	G	A	19: 38,777,893	E2121K	possibly damaging	Het
Prune2	T	A	19: 17,119,342	Y737N	possibly damaging	Het
Ptch1	G	A	13: 63,533,634	P613L	probably benign	Het
Ptprt	A	C	2: 161,555,461	C1129G	probably damaging	Het
Rara	C	T	11: 98,970,157	S157L	probably benign	Het
Rest	T	A	5: 77,268,251	M104K	probably damaging	Het
Rfc1	A	G	5: 65,279,799	S513P	probably damaging	Het
Rnf40	T	A	7: 127,602,636	I1000N	probably damaging	Het
Scube2	C	T	7: 109,831,762	G410E	probably damaging	Het
Sh3gl2	A	G	4: 85,385,852	E264G	probably benign	Het
Shank1	G	A	7: 44,312,918	S71N	unknown	Het
Smc4	T	G	3: 69,007,329	S92A	probably damaging	Het
Spata31d1b	A	G	13: 59,715,653	D205G	probably benign	Het
Spef2	T	C	15: 9,713,117	R390G	probably damaging	Het
Speg	T	C	1: 75,401,124	F842S	probably damaging	Het
Stk17b	G	T	1: 53,757,739	H290N	probably damaging	Het
Stpg3	A	T	2: 25,213,504	V191D	probably benign	Het
Supt6	C	T	11: 78,229,464	R350H	probably damaging	Het
Tet3	T	C	6: 83,403,953	E411G	possibly damaging	Het
Tet3	T	A	6: 83,404,826		probably null	Het
Tns3	A	G	11: 8,445,702	I1234T	probably damaging	Het
Trim34b	A	G	7: 104,331,296	E197G	probably damaging	Het
Vcan	G	T	13: 89,703,412	T1143K	possibly damaging	Het
Vmn2r61	T	A	7: 42,300,169	V671E	probably damaging	Het
Wdtc1	A	G	4: 133,322,218	V29A	probably damaging	Het
Zfp462	G	A	4: 55,080,735	M2450I	probably benign	Het
Zfp869	A	T	8: 69,707,199	C241*	probably null	Het

Other mutations in Cr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00587:Cr2	APN	1	195154251	missense	possibly damaging	0.76
IGL01326:Cr2	APN	1	195141221	missense	probably null	1.00
IGL01358:Cr2	APN	1	195159820	missense	probably damaging	1.00
IGL01410:Cr2	APN	1	195163234	missense	possibly damaging	0.49
IGL01468:Cr2	APN	1	195168535	missense	probably damaging	1.00
IGL01608:Cr2	APN	1	195155220	missense	possibly damaging	0.50
IGL01810:Cr2	APN	1	195159595	missense	possibly damaging	0.49
IGL01843:Cr2	APN	1	195150914	splice site	probably benign
IGL02332:Cr2	APN	1	195160322	missense	probably benign	0.19
IGL02934:Cr2	APN	1	195154325	splice site	probably benign
IGL02938:Cr2	APN	1	195166388	missense	probably damaging	1.00
IGL03149:Cr2	APN	1	195166366	missense	probably damaging	1.00
IGL03327:Cr2	APN	1	195169759	missense	probably damaging	1.00
IGL03346:Cr2	APN	1	195169759	missense	probably damaging	1.00
Pillar	UTSW	1	195155888	nonsense	probably null
PIT4354001:Cr2	UTSW	1	195166309	missense	probably damaging	1.00
PIT4418001:Cr2	UTSW	1	195157452	missense	probably benign	0.08
R0128:Cr2	UTSW	1	195166231	missense	probably damaging	0.99
R0130:Cr2	UTSW	1	195166231	missense	probably damaging	0.99
R0380:Cr2	UTSW	1	195157407	missense	probably damaging	1.00
R0538:Cr2	UTSW	1	195160359	splice site	probably benign
R0605:Cr2	UTSW	1	195163596	splice site	probably benign
R0626:Cr2	UTSW	1	195171111	missense	possibly damaging	0.95
R1135:Cr2	UTSW	1	195157190	missense	probably damaging	1.00
R1396:Cr2	UTSW	1	195169253	splice site	probably null
R1422:Cr2	UTSW	1	195171125	missense	probably benign	0.01
R1467:Cr2	UTSW	1	195157509	missense	probably damaging	1.00
R1467:Cr2	UTSW	1	195157509	missense	probably damaging	1.00
R1511:Cr2	UTSW	1	195155272	missense	possibly damaging	0.92
R1572:Cr2	UTSW	1	195163314	missense	probably damaging	1.00
R1714:Cr2	UTSW	1	195151686	missense	possibly damaging	0.46
R1748:Cr2	UTSW	1	195155905	nonsense	probably null
R1761:Cr2	UTSW	1	195155123	critical splice donor site	probably null
R1824:Cr2	UTSW	1	195157316	missense	probably damaging	1.00
R1893:Cr2	UTSW	1	195155187	missense	probably benign	0.03
R1990:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R1991:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R1992:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R2191:Cr2	UTSW	1	195163381	missense	possibly damaging	0.94
R2276:Cr2	UTSW	1	195157368	missense	possibly damaging	0.94
R2277:Cr2	UTSW	1	195157368	missense	possibly damaging	0.94
R3548:Cr2	UTSW	1	195155888	nonsense	probably null
R3743:Cr2	UTSW	1	195149966	splice site	probably benign
R3941:Cr2	UTSW	1	195165814	missense	probably damaging	0.97
R3963:Cr2	UTSW	1	195159739	missense	probably damaging	1.00
R4211:Cr2	UTSW	1	195156328	missense	probably damaging	0.96
R4484:Cr2	UTSW	1	195154174	missense	probably damaging	1.00
R4546:Cr2	UTSW	1	195171041	missense	possibly damaging	0.94
R4791:Cr2	UTSW	1	195155935	missense	probably damaging	1.00
R4801:Cr2	UTSW	1	195163311	missense	probably damaging	1.00
R4802:Cr2	UTSW	1	195163311	missense	probably damaging	1.00
R4874:Cr2	UTSW	1	195176570	missense	possibly damaging	0.82
R4885:Cr2	UTSW	1	195158731	missense	possibly damaging	0.92
R4889:Cr2	UTSW	1	195176585	missense	possibly damaging	0.70
R5154:Cr2	UTSW	1	195159446	missense	probably damaging	1.00
R5574:Cr2	UTSW	1	195141236	missense	probably damaging	1.00
R5594:Cr2	UTSW	1	195157190	missense	probably damaging	1.00
R5645:Cr2	UTSW	1	195154273	missense	probably damaging	1.00
R5700:Cr2	UTSW	1	195159757	missense	probably damaging	0.96
R5929:Cr2	UTSW	1	195171111	missense	possibly damaging	0.91
R6237:Cr2	UTSW	1	195157502	missense	probably damaging	1.00
R6299:Cr2	UTSW	1	195168646	missense	probably damaging	1.00
R6368:Cr2	UTSW	1	195168472	missense	probably damaging	1.00
R6406:Cr2	UTSW	1	195169771	missense	probably damaging	1.00
R6618:Cr2	UTSW	1	195157379	missense	probably damaging	0.98
R6684:Cr2	UTSW	1	195171021	nonsense	probably null
R6720:Cr2	UTSW	1	195155200	missense	probably damaging	0.97
R6866:Cr2	UTSW	1	195151691	missense	probably damaging	1.00
R6915:Cr2	UTSW	1	195171146	missense	probably benign	0.06
R7057:Cr2	UTSW	1	195151610	missense	possibly damaging	0.83
R7117:Cr2	UTSW	1	195160601	missense	possibly damaging	0.79
R7200:Cr2	UTSW	1	195163249	missense	probably damaging	1.00
R7209:Cr2	UTSW	1	195168724	missense	probably damaging	1.00
R7350:Cr2	UTSW	1	195155286	missense	probably benign	0.21
R7414:Cr2	UTSW	1	195150036	missense	probably benign
R7453:Cr2	UTSW	1	195165257	splice site	probably null
R7479:Cr2	UTSW	1	195158410	critical splice donor site	probably null
R7480:Cr2	UTSW	1	195154176	missense	probably damaging	1.00
R7570:Cr2	UTSW	1	195169340	nonsense	probably null
R7666:Cr2	UTSW	1	195154225	missense	probably damaging	1.00
R7921:Cr2	UTSW	1	195151667	missense	possibly damaging	0.94
R7923:Cr2	UTSW	1	195168687	missense	probably benign	0.03
R8396:Cr2	UTSW	1	195158068	missense	probably damaging	1.00
R8503:Cr2	UTSW	1	195163542	missense	probably benign
R8517:Cr2	UTSW	1	195155899	missense	probably benign	0.03
R8773:Cr2	UTSW	1	195158605	missense	probably damaging	1.00
R8849:Cr2	UTSW	1	195157239	missense	probably damaging	1.00
R8896:Cr2	UTSW	1	195169273	missense	possibly damaging	0.58
R8938:Cr2	UTSW	1	195171116	missense	probably damaging	0.99
R9027:Cr2	UTSW	1	195151721	missense	probably benign	0.08
R9045:Cr2	UTSW	1	195155372	missense	possibly damaging	0.61
R9116:Cr2	UTSW	1	195158669	nonsense	probably null
R9137:Cr2	UTSW	1	195168332	critical splice donor site	probably null
R9497:Cr2	UTSW	1	195168435	missense	probably damaging	0.99
R9510:Cr2	UTSW	1	195158108	missense	probably damaging	0.97
R9752:Cr2	UTSW	1	195141267	missense	probably benign	0.37
R9799:Cr2	UTSW	1	195160680	missense	probably benign	0.02
X0028:Cr2	UTSW	1	195149982	missense	probably benign	0.09
X0066:Cr2	UTSW	1	195166321	missense	probably damaging	0.99
Z1176:Cr2	UTSW	1	195154153	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- TTGACGCAACCCAAAGTAGG -3'
(R):5'- CTATGCAGTTAATGGATGGTGC -3'

Sequencing Primer
(F):5'- CCCAAAGTAGGAATTTTGGCTCC -3'
(R):5'- CAGTTAATGGATGGTGCTGAGG -3'

Posted On

2022-06-15