Mutagenetix > Incidental Mutation

Incidental Mutation 'R9476:Ptprt'

715753

Institutional Source

Beutler Lab

Gene Symbol

Ptprt

Ensembl Gene

ENSMUSG00000053141

Gene Name

protein tyrosine phosphatase, receptor type, T

Synonyms

RPTPrho

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.101) question?

Stock #

R9476 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

161521990-162661147 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 161555461 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Glycine at position 1129 (C1129G)

Ref Sequence

ENSEMBL: ENSMUSP00000105067 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109441] [ENSMUST00000109442] [ENSMUST00000109443] [ENSMUST00000109445]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000109441
AA Change: C1129G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105067
Gene: ENSMUSG00000053141
AA Change: C1129G

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
MAM	31	195	2.21e-71	SMART
IG	202	290	3.94e-2	SMART
FN3	292	375	3.35e-3	SMART
FN3	388	477	4.06e-2	SMART
FN3	489	579	1.2e-4	SMART
transmembrane domain	753	772	N/A	INTRINSIC
PTPc	882	1159	3.64e-129	SMART
PTPc	1188	1453	4.24e-98	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000109442
AA Change: C1128G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105068
Gene: ENSMUSG00000053141
AA Change: C1128G

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
MAM	31	195	2.21e-71	SMART
IG	202	290	3.94e-2	SMART
FN3	292	375	3.35e-3	SMART
FN3	388	477	4.06e-2	SMART
FN3	489	579	1.2e-4	SMART
low complexity region	738	749	N/A	INTRINSIC
transmembrane domain	772	791	N/A	INTRINSIC
PTPc	901	1158	5.56e-134	SMART
PTPc	1187	1452	4.24e-98	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000109443
AA Change: C1119G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105069
Gene: ENSMUSG00000053141
AA Change: C1119G

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
MAM	31	195	2.21e-71	SMART
IG	202	290	3.94e-2	SMART
FN3	292	375	3.35e-3	SMART
FN3	388	477	4.06e-2	SMART
FN3	489	579	1.2e-4	SMART
low complexity region	778	792	N/A	INTRINSIC
PTPc	892	1149	5.56e-134	SMART
PTPc	1178	1443	4.24e-98	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000109445
AA Change: C1109G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105071
Gene: ENSMUSG00000053141
AA Change: C1109G

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
MAM	31	195	2.21e-71	SMART
IG	202	290	3.94e-2	SMART
FN3	292	375	3.35e-3	SMART
FN3	388	477	4.06e-2	SMART
FN3	489	579	1.2e-4	SMART
transmembrane domain	753	772	N/A	INTRINSIC
PTPc	882	1139	5.56e-134	SMART
PTPc	1168	1433	4.24e-98	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. The protein domain structure and the expression pattern of the mouse counterpart of this PTP suggest its roles in both signal transduction and cellular adhesion in the central nervous system. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are highly susceptible to carcinogen azoxymethane-induced colon tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930578G10Rik	T	G	4: 42,760,998	W6G	unknown	Het
Aatk	A	T	11: 120,010,268	C1101S	probably benign	Het
Abcb4	A	T	5: 8,927,790	D456V	probably damaging	Het
Abcc8	T	C	7: 46,169,846	E186G	possibly damaging	Het
Adam18	T	C	8: 24,625,791	N629S	probably benign	Het
Angpt2	T	G	8: 18,714,127	N133T	probably benign	Het
Ankrd13c	T	A	3: 157,991,759	S334T	probably benign	Het
Ankrd13d	A	T	19: 4,270,261	S151T	unknown	Het
Ap3d1	G	A	10: 80,709,821	P1025S	probably benign	Het
Bhlhe41	G	A	6: 145,863,222	A288V	possibly damaging	Het
Cacna1b	T	C	2: 24,650,046	E1467G	probably damaging	Het
Cacna1h	T	A	17: 25,392,550	T425S	probably damaging	Het
Cdk13	A	C	13: 17,728,162	C934W	probably damaging	Het
Ces1b	T	A	8: 93,073,262	N162I	probably damaging	Het
Clec9a	T	A	6: 129,421,060	I187K	possibly damaging	Het
Cpsf3	A	G	12: 21,300,079	I266M	probably damaging	Het
Cr2	G	T	1: 195,158,108	L509M	probably damaging	Het
Creb3l2	C	A	6: 37,334,511	G448W	probably damaging	Het
Csmd1	T	A	8: 15,931,215		probably null	Het
Cul9	G	A	17: 46,510,907	R1881W	probably damaging	Het
Cyth1	C	T	11: 118,185,380		probably null	Het
Dnhd1	A	T	7: 105,703,682	N2681Y	possibly damaging	Het
Dnm1	T	C	2: 32,323,727	M476V	probably benign	Het
Dnmt3a	A	G	12: 3,907,707	H896R	probably damaging	Het
Dock1	T	G	7: 134,990,550	I938S	probably benign	Het
Dock6	G	A	9: 21,813,525	L1515F	probably damaging	Het
Dusp16	T	C	6: 134,718,263	H535R	probably benign	Het
Fancd2os	T	A	6: 113,598,033	Y4F	probably damaging	Het
Fat4	A	T	3: 38,983,737	Q3846L	probably benign	Het
Fbxw10	A	C	11: 62,852,988	H240P	probably benign	Het
Frmd4a	A	G	2: 4,603,513	T731A	probably benign	Het
Gm44501	T	A	17: 40,578,929	H111Q	possibly damaging	Het
Gm8765	A	G	13: 50,702,113	T596A	possibly damaging	Het
Gsdmc	T	C	15: 63,778,702	M277V	probably benign	Het
Hira	A	G	16: 18,954,039	D867G	probably damaging	Het
Hmcn1	A	G	1: 150,586,376	S5184P	probably benign	Het
Ighv1-26	A	C	12: 114,788,787	F7V	probably benign	Het
Igkv4-81	C	T	6: 68,990,812	E102K	possibly damaging	Het
Inmt	G	T	6: 55,171,005	S213Y	possibly damaging	Het
Ints2	T	A	11: 86,244,509	M360L	probably benign	Het
Itih3	A	G	14: 30,909,459	S827P	probably benign	Het
Itpr3	G	A	17: 27,118,677		probably benign	Het
Kcnk12	C	A	17: 87,746,694	R180L	probably benign	Het
Kndc1	G	A	7: 139,930,118	S1291N	probably benign	Het
Mettl21a	T	C	1: 64,608,126	T91A	probably damaging	Het
Mmrn2	A	G	14: 34,398,450	I426V	possibly damaging	Het
Mrpl21	T	G	19: 3,287,704	V137G	probably damaging	Het
Nrbp2	T	C	15: 76,089,777	N218S	probably damaging	Het
Nrip1	T	C	16: 76,292,932	N579S	probably benign	Het
Nsf	T	C	11: 103,873,162	N365S	probably damaging	Het
Olfr774	A	G	10: 129,238,787	I213V	probably damaging	Het
Olfr846	A	T	9: 19,361,087	D89E	probably benign	Het
Osbpl3	C	T	6: 50,336,214		probably null	Het
Oscar	T	A	7: 3,611,844	H43L	probably benign	Het
Pam	C	T	1: 97,898,340		probably null	Het
Parn	A	T	16: 13,541,078	M600K	probably benign	Het
Pcdha11	C	A	18: 37,006,479	T387N	probably benign	Het
Plce1	G	A	19: 38,777,893	E2121K	possibly damaging	Het
Prune2	T	A	19: 17,119,342	Y737N	possibly damaging	Het
Ptch1	G	A	13: 63,533,634	P613L	probably benign	Het
Rara	C	T	11: 98,970,157	S157L	probably benign	Het
Rest	T	A	5: 77,268,251	M104K	probably damaging	Het
Rfc1	A	G	5: 65,279,799	S513P	probably damaging	Het
Rnf40	T	A	7: 127,602,636	I1000N	probably damaging	Het
Scube2	C	T	7: 109,831,762	G410E	probably damaging	Het
Sh3gl2	A	G	4: 85,385,852	E264G	probably benign	Het
Shank1	G	A	7: 44,312,918	S71N	unknown	Het
Smc4	T	G	3: 69,007,329	S92A	probably damaging	Het
Spata31d1b	A	G	13: 59,715,653	D205G	probably benign	Het
Spef2	T	C	15: 9,713,117	R390G	probably damaging	Het
Speg	T	C	1: 75,401,124	F842S	probably damaging	Het
Stk17b	G	T	1: 53,757,739	H290N	probably damaging	Het
Stpg3	A	T	2: 25,213,504	V191D	probably benign	Het
Supt6	C	T	11: 78,229,464	R350H	probably damaging	Het
Tet3	T	C	6: 83,403,953	E411G	possibly damaging	Het
Tet3	T	A	6: 83,404,826		probably null	Het
Tns3	A	G	11: 8,445,702	I1234T	probably damaging	Het
Trim34b	A	G	7: 104,331,296	E197G	probably damaging	Het
Vcan	G	T	13: 89,703,412	T1143K	possibly damaging	Het
Vmn2r61	T	A	7: 42,300,169	V671E	probably damaging	Het
Wdtc1	A	G	4: 133,322,218	V29A	probably damaging	Het
Zfp462	G	A	4: 55,080,735	M2450I	probably benign	Het
Zfp869	A	T	8: 69,707,199	C241*	probably null	Het

Other mutations in Ptprt

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Ptprt	APN	2	161810624	missense	probably benign	0.00
IGL00565:Ptprt	APN	2	161560191	missense	probably damaging	1.00
IGL00925:Ptprt	APN	2	161656163	missense	possibly damaging	0.52
IGL01344:Ptprt	APN	2	161551817	missense	probably damaging	1.00
IGL01432:Ptprt	APN	2	162268079	splice site	probably benign
IGL02008:Ptprt	APN	2	161927673	missense	probably benign	0.02
IGL02040:Ptprt	APN	2	162238072	missense	probably damaging	1.00
IGL02172:Ptprt	APN	2	161555502	missense	probably damaging	1.00
IGL02231:Ptprt	APN	2	162238060	missense	probably damaging	1.00
IGL02231:Ptprt	APN	2	162278046	critical splice donor site	probably null
IGL02232:Ptprt	APN	2	161530517	missense	probably damaging	0.96
IGL02277:Ptprt	APN	2	161547381	missense	probably damaging	1.00
IGL02447:Ptprt	APN	2	162278107	missense	probably benign	0.01
IGL02601:Ptprt	APN	2	161766307	missense	probably benign	0.10
IGL02623:Ptprt	APN	2	161607452	splice site	probably benign
IGL03379:Ptprt	APN	2	161555459	nonsense	probably null
Poverina	UTSW	2	161901497	missense	possibly damaging	0.70
IGL03055:Ptprt	UTSW	2	161533613	missense	probably damaging	0.96
R0064:Ptprt	UTSW	2	161927791	splice site	probably benign
R0129:Ptprt	UTSW	2	162278070	missense	probably benign	0.35
R0131:Ptprt	UTSW	2	162278110	missense	probably benign	0.00
R0131:Ptprt	UTSW	2	162278110	missense	probably benign	0.00
R0132:Ptprt	UTSW	2	162278110	missense	probably benign	0.00
R0316:Ptprt	UTSW	2	161607319	missense	probably damaging	1.00
R0454:Ptprt	UTSW	2	161553822	missense	probably damaging	0.96
R0488:Ptprt	UTSW	2	161553825	missense	probably damaging	0.99
R0573:Ptprt	UTSW	2	161551748	missense	probably damaging	1.00
R0614:Ptprt	UTSW	2	161812120	missense	possibly damaging	0.59
R0834:Ptprt	UTSW	2	161812139	splice site	probably null
R1023:Ptprt	UTSW	2	161558943	missense	probably damaging	1.00
R1184:Ptprt	UTSW	2	161927772	missense	possibly damaging	0.82
R1253:Ptprt	UTSW	2	162278226	missense	probably damaging	1.00
R1476:Ptprt	UTSW	2	161927484	missense	probably damaging	1.00
R1515:Ptprt	UTSW	2	162238034	missense	probably damaging	1.00
R1595:Ptprt	UTSW	2	161810549	critical splice donor site	probably null
R1939:Ptprt	UTSW	2	161927640	missense	probably benign	0.45
R1987:Ptprt	UTSW	2	161558898	missense	probably damaging	1.00
R1987:Ptprt	UTSW	2	161766321	missense	possibly damaging	0.48
R2049:Ptprt	UTSW	2	161534545	missense	probably damaging	1.00
R2140:Ptprt	UTSW	2	161811988	missense	probably damaging	1.00
R2421:Ptprt	UTSW	2	162278040	splice site	probably benign
R3432:Ptprt	UTSW	2	161927529	missense	probably damaging	1.00
R3619:Ptprt	UTSW	2	161566157	missense	probably damaging	1.00
R3757:Ptprt	UTSW	2	161812030	missense	probably damaging	1.00
R3758:Ptprt	UTSW	2	161812030	missense	probably damaging	1.00
R3834:Ptprt	UTSW	2	161547387	missense	probably damaging	1.00
R3835:Ptprt	UTSW	2	161547387	missense	probably damaging	1.00
R3915:Ptprt	UTSW	2	161555555	splice site	probably benign
R4003:Ptprt	UTSW	2	161566117	splice site	probably benign
R4387:Ptprt	UTSW	2	161927650	missense	probably damaging	1.00
R4519:Ptprt	UTSW	2	161564689	missense	probably damaging	1.00
R4618:Ptprt	UTSW	2	161553845	missense	probably damaging	1.00
R4677:Ptprt	UTSW	2	161901446	critical splice donor site	probably null
R4866:Ptprt	UTSW	2	161560239	missense	probably damaging	1.00
R5088:Ptprt	UTSW	2	162238175	missense	probably benign	0.01
R5173:Ptprt	UTSW	2	161927756	missense	probably benign	0.01
R5215:Ptprt	UTSW	2	162278164	missense	probably damaging	1.00
R5383:Ptprt	UTSW	2	161698049	missense	probably damaging	1.00
R5398:Ptprt	UTSW	2	161927592	missense	probably damaging	1.00
R5518:Ptprt	UTSW	2	162278223	missense	probably damaging	0.99
R5711:Ptprt	UTSW	2	161810604	missense	probably damaging	0.98
R5735:Ptprt	UTSW	2	161534564	missense	probably damaging	0.98
R5834:Ptprt	UTSW	2	161560269	missense	probably damaging	1.00
R5872:Ptprt	UTSW	2	162135218	missense	probably damaging	1.00
R5926:Ptprt	UTSW	2	161564686	missense	probably benign	0.00
R6210:Ptprt	UTSW	2	162268029	missense	probably damaging	1.00
R6285:Ptprt	UTSW	2	161901497	missense	possibly damaging	0.70
R6298:Ptprt	UTSW	2	161553859	missense	probably damaging	1.00
R6406:Ptprt	UTSW	2	161553783	missense	probably damaging	0.98
R6499:Ptprt	UTSW	2	161534587	missense	probably benign	0.32
R6613:Ptprt	UTSW	2	161530447	missense	probably damaging	1.00
R6622:Ptprt	UTSW	2	161553840	missense	probably damaging	1.00
R7218:Ptprt	UTSW	2	161547364	missense	probably damaging	1.00
R7247:Ptprt	UTSW	2	161533523	missense	probably benign	0.15
R7576:Ptprt	UTSW	2	161607305	missense	possibly damaging	0.88
R7733:Ptprt	UTSW	2	161575787	missense	probably damaging	1.00
R7735:Ptprt	UTSW	2	161575741	missense	probably damaging	1.00
R7813:Ptprt	UTSW	2	161530493	missense	probably damaging	1.00
R8031:Ptprt	UTSW	2	162135457	missense	probably damaging	1.00
R8074:Ptprt	UTSW	2	161927661	missense	possibly damaging	0.77
R8151:Ptprt	UTSW	2	162278085	missense	probably damaging	1.00
R8236:Ptprt	UTSW	2	161687068	critical splice donor site	probably null
R8308:Ptprt	UTSW	2	161927646	missense	probably benign	0.00
R8348:Ptprt	UTSW	2	161558886	missense	probably damaging	1.00
R8362:Ptprt	UTSW	2	161551747	missense	probably damaging	1.00
R8365:Ptprt	UTSW	2	161901531	missense	probably benign	0.05
R8448:Ptprt	UTSW	2	161558886	missense	probably damaging	1.00
R8512:Ptprt	UTSW	2	161558863	missense	probably benign	0.00
R8715:Ptprt	UTSW	2	161530543	missense	probably damaging	1.00
R9004:Ptprt	UTSW	2	161766394	missense	probably benign	0.04
R9046:Ptprt	UTSW	2	161530441	missense	possibly damaging	0.58
R9222:Ptprt	UTSW	2	161560186	missense	probably damaging	1.00
R9297:Ptprt	UTSW	2	161575778	missense	probably benign
R9318:Ptprt	UTSW	2	161575778	missense	probably benign
R9510:Ptprt	UTSW	2	161555461	missense	probably damaging	1.00
R9571:Ptprt	UTSW	2	161553812	missense	probably benign	0.10
X0064:Ptprt	UTSW	2	161927483	missense	probably damaging	1.00
Z1088:Ptprt	UTSW	2	162238121	missense	possibly damaging	0.86
Z1177:Ptprt	UTSW	2	161732887	missense	probably damaging	1.00
Z1177:Ptprt	UTSW	2	162362948	missense	possibly damaging	0.77

Predicted Primers

PCR Primer
(F):5'- ATTGGTCTGGACATCTCCCC -3'
(R):5'- CAGCAAGGCTTTTGAGATAAGGTC -3'

Sequencing Primer
(F):5'- CCCATATCGAGTTATATAGGTACCC -3'
(R):5'- TCAAATGGTAGGGGCCTTATCACC -3'

Posted On

2022-06-15