Incidental Mutation 'R9476:Scube2'
ID 715780
Institutional Source Beutler Lab
Gene Symbol Scube2
Ensembl Gene ENSMUSG00000007279
Gene Name signal peptide, CUB domain, EGF-like 2
Synonyms ICRFP703N2430Q5.1, 4932442O19Rik, Cegf1, ICRFP703B1614Q5.1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.440) question?
Stock # R9476 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 109798676-109865679 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 109831762 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Glutamic Acid at position 410 (G410E)
Ref Sequence ENSEMBL: ENSMUSP00000102340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007423] [ENSMUST00000106728] [ENSMUST00000106729]
AlphaFold Q9JJS0
Predicted Effect probably damaging
Transcript: ENSMUST00000007423
AA Change: G410E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000007423
Gene: ENSMUSG00000007279
AA Change: G410E

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 479 490 N/A INTRINSIC
low complexity region 577 594 N/A INTRINSIC
Pfam:GCC2_GCC3 642 692 7.2e-19 PFAM
Pfam:GCC2_GCC3 699 746 2e-16 PFAM
Pfam:GCC2_GCC3 755 802 3.1e-18 PFAM
CUB 807 919 1.23e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106728
AA Change: G410E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102339
Gene: ENSMUSG00000007279
AA Change: G410E

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 451 468 N/A INTRINSIC
Pfam:GCC2_GCC3 516 566 6.4e-17 PFAM
Pfam:GCC2_GCC3 573 620 3.5e-14 PFAM
Pfam:GCC2_GCC3 629 676 5.4e-16 PFAM
Blast:CUB 678 727 2e-25 BLAST
Blast:CUB 730 796 1e-37 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000106729
AA Change: G410E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102340
Gene: ENSMUSG00000007279
AA Change: G410E

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 605 622 N/A INTRINSIC
Pfam:GCC2_GCC3 670 717 1.8e-16 PFAM
Pfam:GCC2_GCC3 726 773 2.7e-18 PFAM
CUB 778 890 1.23e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are smaller than controls. Mice also exhibit defective endochondral bone formation and impaired Ihh-mediated chondrocyte differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578G10Rik T G 4: 42,760,998 W6G unknown Het
Aatk A T 11: 120,010,268 C1101S probably benign Het
Abcb4 A T 5: 8,927,790 D456V probably damaging Het
Abcc8 T C 7: 46,169,846 E186G possibly damaging Het
Adam18 T C 8: 24,625,791 N629S probably benign Het
Angpt2 T G 8: 18,714,127 N133T probably benign Het
Ankrd13c T A 3: 157,991,759 S334T probably benign Het
Ankrd13d A T 19: 4,270,261 S151T unknown Het
Ap3d1 G A 10: 80,709,821 P1025S probably benign Het
Bhlhe41 G A 6: 145,863,222 A288V possibly damaging Het
Cacna1b T C 2: 24,650,046 E1467G probably damaging Het
Cacna1h T A 17: 25,392,550 T425S probably damaging Het
Cdk13 A C 13: 17,728,162 C934W probably damaging Het
Ces1b T A 8: 93,073,262 N162I probably damaging Het
Clec9a T A 6: 129,421,060 I187K possibly damaging Het
Cpsf3 A G 12: 21,300,079 I266M probably damaging Het
Cr2 G T 1: 195,158,108 L509M probably damaging Het
Creb3l2 C A 6: 37,334,511 G448W probably damaging Het
Csmd1 T A 8: 15,931,215 probably null Het
Cul9 G A 17: 46,510,907 R1881W probably damaging Het
Cyth1 C T 11: 118,185,380 probably null Het
Dnhd1 A T 7: 105,703,682 N2681Y possibly damaging Het
Dnm1 T C 2: 32,323,727 M476V probably benign Het
Dnmt3a A G 12: 3,907,707 H896R probably damaging Het
Dock1 T G 7: 134,990,550 I938S probably benign Het
Dock6 G A 9: 21,813,525 L1515F probably damaging Het
Dusp16 T C 6: 134,718,263 H535R probably benign Het
Fancd2os T A 6: 113,598,033 Y4F probably damaging Het
Fat4 A T 3: 38,983,737 Q3846L probably benign Het
Fbxw10 A C 11: 62,852,988 H240P probably benign Het
Frmd4a A G 2: 4,603,513 T731A probably benign Het
Gm44501 T A 17: 40,578,929 H111Q possibly damaging Het
Gm8765 A G 13: 50,702,113 T596A possibly damaging Het
Gsdmc T C 15: 63,778,702 M277V probably benign Het
Hira A G 16: 18,954,039 D867G probably damaging Het
Hmcn1 A G 1: 150,586,376 S5184P probably benign Het
Ighv1-26 A C 12: 114,788,787 F7V probably benign Het
Igkv4-81 C T 6: 68,990,812 E102K possibly damaging Het
Inmt G T 6: 55,171,005 S213Y possibly damaging Het
Ints2 T A 11: 86,244,509 M360L probably benign Het
Itih3 A G 14: 30,909,459 S827P probably benign Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kcnk12 C A 17: 87,746,694 R180L probably benign Het
Kndc1 G A 7: 139,930,118 S1291N probably benign Het
Mettl21a T C 1: 64,608,126 T91A probably damaging Het
Mmrn2 A G 14: 34,398,450 I426V possibly damaging Het
Mrpl21 T G 19: 3,287,704 V137G probably damaging Het
Nrbp2 T C 15: 76,089,777 N218S probably damaging Het
Nrip1 T C 16: 76,292,932 N579S probably benign Het
Nsf T C 11: 103,873,162 N365S probably damaging Het
Olfr774 A G 10: 129,238,787 I213V probably damaging Het
Olfr846 A T 9: 19,361,087 D89E probably benign Het
Osbpl3 C T 6: 50,336,214 probably null Het
Oscar T A 7: 3,611,844 H43L probably benign Het
Pam C T 1: 97,898,340 probably null Het
Parn A T 16: 13,541,078 M600K probably benign Het
Pcdha11 C A 18: 37,006,479 T387N probably benign Het
Plce1 G A 19: 38,777,893 E2121K possibly damaging Het
Prune2 T A 19: 17,119,342 Y737N possibly damaging Het
Ptch1 G A 13: 63,533,634 P613L probably benign Het
Ptprt A C 2: 161,555,461 C1129G probably damaging Het
Rara C T 11: 98,970,157 S157L probably benign Het
Rest T A 5: 77,268,251 M104K probably damaging Het
Rfc1 A G 5: 65,279,799 S513P probably damaging Het
Rnf40 T A 7: 127,602,636 I1000N probably damaging Het
Sh3gl2 A G 4: 85,385,852 E264G probably benign Het
Shank1 G A 7: 44,312,918 S71N unknown Het
Smc4 T G 3: 69,007,329 S92A probably damaging Het
Spata31d1b A G 13: 59,715,653 D205G probably benign Het
Spef2 T C 15: 9,713,117 R390G probably damaging Het
Speg T C 1: 75,401,124 F842S probably damaging Het
Stk17b G T 1: 53,757,739 H290N probably damaging Het
Stpg3 A T 2: 25,213,504 V191D probably benign Het
Supt6 C T 11: 78,229,464 R350H probably damaging Het
Tet3 T C 6: 83,403,953 E411G possibly damaging Het
Tet3 T A 6: 83,404,826 probably null Het
Tns3 A G 11: 8,445,702 I1234T probably damaging Het
Trim34b A G 7: 104,331,296 E197G probably damaging Het
Vcan G T 13: 89,703,412 T1143K possibly damaging Het
Vmn2r61 T A 7: 42,300,169 V671E probably damaging Het
Wdtc1 A G 4: 133,322,218 V29A probably damaging Het
Zfp462 G A 4: 55,080,735 M2450I probably benign Het
Zfp869 A T 8: 69,707,199 C241* probably null Het
Other mutations in Scube2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Scube2 APN 7 109808454 missense probably damaging 1.00
IGL01608:Scube2 APN 7 109843254 missense probably benign
IGL02080:Scube2 APN 7 109852478 missense probably damaging 1.00
PIT4445001:Scube2 UTSW 7 109809180 missense probably benign 0.22
R0020:Scube2 UTSW 7 109830888 splice site probably benign
R0020:Scube2 UTSW 7 109830888 splice site probably benign
R0106:Scube2 UTSW 7 109846908 splice site probably benign
R0230:Scube2 UTSW 7 109824764 critical splice donor site probably null
R0255:Scube2 UTSW 7 109824872 missense probably damaging 0.98
R0427:Scube2 UTSW 7 109824837 missense probably benign 0.00
R0612:Scube2 UTSW 7 109804764 splice site probably benign
R0658:Scube2 UTSW 7 109837120 splice site probably benign
R0687:Scube2 UTSW 7 109829128 missense possibly damaging 0.47
R1087:Scube2 UTSW 7 109831675 missense probably damaging 1.00
R1366:Scube2 UTSW 7 109804614 missense probably damaging 1.00
R1635:Scube2 UTSW 7 109843214 missense possibly damaging 0.90
R1797:Scube2 UTSW 7 109831675 missense probably damaging 1.00
R1972:Scube2 UTSW 7 109809214 missense probably benign 0.16
R2080:Scube2 UTSW 7 109808505 missense possibly damaging 0.77
R2254:Scube2 UTSW 7 109825459 missense possibly damaging 0.47
R2315:Scube2 UTSW 7 109804701 missense probably damaging 1.00
R2325:Scube2 UTSW 7 109843954 missense probably damaging 1.00
R3723:Scube2 UTSW 7 109808406 splice site probably benign
R3887:Scube2 UTSW 7 109843176 splice site probably benign
R3946:Scube2 UTSW 7 109857590 missense possibly damaging 0.81
R4030:Scube2 UTSW 7 109831771 missense probably benign 0.09
R4621:Scube2 UTSW 7 109800650 missense possibly damaging 0.63
R4684:Scube2 UTSW 7 109810713 missense probably damaging 0.96
R4736:Scube2 UTSW 7 109831205 missense probably benign 0.01
R5096:Scube2 UTSW 7 109799244 utr 3 prime probably benign
R5266:Scube2 UTSW 7 109809230 missense probably damaging 1.00
R5579:Scube2 UTSW 7 109810737 missense probably damaging 1.00
R5669:Scube2 UTSW 7 109825439 missense probably benign 0.04
R5838:Scube2 UTSW 7 109808444 missense probably damaging 1.00
R5916:Scube2 UTSW 7 109831724 missense possibly damaging 0.77
R6056:Scube2 UTSW 7 109833013 nonsense probably null
R6731:Scube2 UTSW 7 109810737 missense probably damaging 1.00
R6785:Scube2 UTSW 7 109810617 missense probably benign
R8197:Scube2 UTSW 7 109808477 missense possibly damaging 0.53
R8250:Scube2 UTSW 7 109864170 missense probably benign 0.20
R8273:Scube2 UTSW 7 109809176 missense probably benign 0.00
R8427:Scube2 UTSW 7 109800590 missense probably damaging 1.00
R8882:Scube2 UTSW 7 109852473 missense probably damaging 1.00
R9258:Scube2 UTSW 7 109799308 missense probably damaging 1.00
R9428:Scube2 UTSW 7 109829138 missense probably benign 0.32
R9510:Scube2 UTSW 7 109831762 missense probably damaging 1.00
R9709:Scube2 UTSW 7 109831764 missense probably damaging 1.00
Z1177:Scube2 UTSW 7 109838127 missense probably damaging 1.00
Z1177:Scube2 UTSW 7 109843201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGTGGAGTATGCAAGCAC -3'
(R):5'- TGGTTAAAACTCTCAACCAAGGC -3'

Sequencing Primer
(F):5'- TGGAGTATGCAAGCACACAGTCTC -3'
(R):5'- GTTAAAACTCTCAACCAAGGCACATG -3'
Posted On 2022-06-15