Incidental Mutation 'R9476:Kndc1'
ID 715783
Institutional Source Beutler Lab
Gene Symbol Kndc1
Ensembl Gene ENSMUSG00000066129
Gene Name kinase non-catalytic C-lobe domain (KIND) containing 1
Synonyms B830014K08Rik, VKIND, very-kind, 2410012C07Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9476 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 139474612-139521450 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 139510031 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 1291 (S1291N)
Ref Sequence ENSEMBL: ENSMUSP00000050586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053445]
AlphaFold Q0KK55
Predicted Effect probably benign
Transcript: ENSMUST00000053445
AA Change: S1291N

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000050586
Gene: ENSMUSG00000066129
AA Change: S1291N

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
KIND 456 620 1.22e-50 SMART
low complexity region 658 670 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 792 801 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
coiled coil region 1121 1151 N/A INTRINSIC
Pfam:RasGEF_N 1242 1341 2.2e-17 PFAM
Pfam:RasGEF 1464 1672 3.8e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Ras guanine nucleotide exchange factor that appears to negatively regulate dendritic growth in the brain. Knockdown of this gene in senescent umbilical vein endothelial cells partially reversed the senescence, showing that this gene could potentially be targeted by anti-aging therapies. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578G10Rik T G 4: 42,760,998 (GRCm39) W6G unknown Het
Aatk A T 11: 119,901,094 (GRCm39) C1101S probably benign Het
Abcb4 A T 5: 8,977,790 (GRCm39) D456V probably damaging Het
Abcc8 T C 7: 45,819,270 (GRCm39) E186G possibly damaging Het
Adam18 T C 8: 25,115,807 (GRCm39) N629S probably benign Het
Angpt2 T G 8: 18,764,143 (GRCm39) N133T probably benign Het
Ankrd13c T A 3: 157,697,396 (GRCm39) S334T probably benign Het
Ankrd13d A T 19: 4,320,289 (GRCm39) S151T unknown Het
Ap3d1 G A 10: 80,545,655 (GRCm39) P1025S probably benign Het
Bhlhe41 G A 6: 145,808,948 (GRCm39) A288V possibly damaging Het
Cacna1b T C 2: 24,540,058 (GRCm39) E1467G probably damaging Het
Cacna1h T A 17: 25,611,524 (GRCm39) T425S probably damaging Het
Cdk13 A C 13: 17,902,747 (GRCm39) C934W probably damaging Het
Ces1b T A 8: 93,799,890 (GRCm39) N162I probably damaging Het
Clec9a T A 6: 129,398,023 (GRCm39) I187K possibly damaging Het
Cpsf3 A G 12: 21,350,080 (GRCm39) I266M probably damaging Het
Cr2 G T 1: 194,840,416 (GRCm39) L509M probably damaging Het
Creb3l2 C A 6: 37,311,446 (GRCm39) G448W probably damaging Het
Csmd1 T A 8: 15,981,215 (GRCm39) probably null Het
Cul9 G A 17: 46,821,833 (GRCm39) R1881W probably damaging Het
Cyth1 C T 11: 118,076,206 (GRCm39) probably null Het
Dnhd1 A T 7: 105,352,889 (GRCm39) N2681Y possibly damaging Het
Dnm1 T C 2: 32,213,739 (GRCm39) M476V probably benign Het
Dnmt3a A G 12: 3,957,707 (GRCm39) H896R probably damaging Het
Dock1 T G 7: 134,592,279 (GRCm39) I938S probably benign Het
Dock6 G A 9: 21,724,821 (GRCm39) L1515F probably damaging Het
Dusp16 T C 6: 134,695,226 (GRCm39) H535R probably benign Het
Fancd2os T A 6: 113,574,994 (GRCm39) Y4F probably damaging Het
Fat4 A T 3: 39,037,886 (GRCm39) Q3846L probably benign Het
Fbxw10 A C 11: 62,743,814 (GRCm39) H240P probably benign Het
Frmd4a A G 2: 4,608,324 (GRCm39) T731A probably benign Het
Gm44501 T A 17: 40,889,820 (GRCm39) H111Q possibly damaging Het
Gsdmc T C 15: 63,650,551 (GRCm39) M277V probably benign Het
Hira A G 16: 18,772,789 (GRCm39) D867G probably damaging Het
Hmcn1 A G 1: 150,462,127 (GRCm39) S5184P probably benign Het
Ighv1-26 A C 12: 114,752,407 (GRCm39) F7V probably benign Het
Igkv4-81 C T 6: 68,967,796 (GRCm39) E102K possibly damaging Het
Inmt G T 6: 55,147,990 (GRCm39) S213Y possibly damaging Het
Ints2 T A 11: 86,135,335 (GRCm39) M360L probably benign Het
Itih3 A G 14: 30,631,416 (GRCm39) S827P probably benign Het
Itpr3 G A 17: 27,337,651 (GRCm39) probably benign Het
Kcnk12 C A 17: 88,054,122 (GRCm39) R180L probably benign Het
Mettl21a T C 1: 64,647,285 (GRCm39) T91A probably damaging Het
Mmrn2 A G 14: 34,120,407 (GRCm39) I426V possibly damaging Het
Mrpl21 T G 19: 3,337,704 (GRCm39) V137G probably damaging Het
Nrbp2 T C 15: 75,961,626 (GRCm39) N218S probably damaging Het
Nrip1 T C 16: 76,089,820 (GRCm39) N579S probably benign Het
Nsf T C 11: 103,763,988 (GRCm39) N365S probably damaging Het
Or6c5 A G 10: 129,074,656 (GRCm39) I213V probably damaging Het
Or7g28 A T 9: 19,272,383 (GRCm39) D89E probably benign Het
Osbpl3 C T 6: 50,313,194 (GRCm39) probably null Het
Oscar T A 7: 3,614,843 (GRCm39) H43L probably benign Het
Pam C T 1: 97,826,065 (GRCm39) probably null Het
Parn A T 16: 13,358,942 (GRCm39) M600K probably benign Het
Pcdha11 C A 18: 37,139,532 (GRCm39) T387N probably benign Het
Plce1 G A 19: 38,766,337 (GRCm39) E2121K possibly damaging Het
Prune2 T A 19: 17,096,706 (GRCm39) Y737N possibly damaging Het
Ptch1 G A 13: 63,681,448 (GRCm39) P613L probably benign Het
Ptprt A C 2: 161,397,381 (GRCm39) C1129G probably damaging Het
Rara C T 11: 98,860,983 (GRCm39) S157L probably benign Het
Rest T A 5: 77,416,098 (GRCm39) M104K probably damaging Het
Rfc1 A G 5: 65,437,142 (GRCm39) S513P probably damaging Het
Rnf40 T A 7: 127,201,808 (GRCm39) I1000N probably damaging Het
Scube2 C T 7: 109,430,969 (GRCm39) G410E probably damaging Het
Sh3gl2 A G 4: 85,304,089 (GRCm39) E264G probably benign Het
Shank1 G A 7: 43,962,342 (GRCm39) S71N unknown Het
Smc4 T G 3: 68,914,662 (GRCm39) S92A probably damaging Het
Spata31d1b A G 13: 59,863,467 (GRCm39) D205G probably benign Het
Spata31e4 A G 13: 50,856,149 (GRCm39) T596A possibly damaging Het
Spef2 T C 15: 9,713,203 (GRCm39) R390G probably damaging Het
Speg T C 1: 75,377,768 (GRCm39) F842S probably damaging Het
Stk17b G T 1: 53,796,898 (GRCm39) H290N probably damaging Het
Stpg3 A T 2: 25,103,516 (GRCm39) V191D probably benign Het
Supt6 C T 11: 78,120,290 (GRCm39) R350H probably damaging Het
Tet3 T C 6: 83,380,935 (GRCm39) E411G possibly damaging Het
Tet3 T A 6: 83,381,808 (GRCm39) probably null Het
Tns3 A G 11: 8,395,702 (GRCm39) I1234T probably damaging Het
Trim34b A G 7: 103,980,503 (GRCm39) E197G probably damaging Het
Vcan G T 13: 89,851,531 (GRCm39) T1143K possibly damaging Het
Vmn2r61 T A 7: 41,949,593 (GRCm39) V671E probably damaging Het
Wdtc1 A G 4: 133,049,529 (GRCm39) V29A probably damaging Het
Zfp462 G A 4: 55,080,735 (GRCm39) M2450I probably benign Het
Zfp869 A T 8: 70,159,849 (GRCm39) C241* probably null Het
Other mutations in Kndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Kndc1 APN 7 139,481,904 (GRCm39) splice site probably benign
IGL01061:Kndc1 APN 7 139,502,610 (GRCm39) missense probably benign 0.00
IGL01099:Kndc1 APN 7 139,500,700 (GRCm39) missense probably damaging 1.00
IGL01522:Kndc1 APN 7 139,493,888 (GRCm39) splice site probably benign
IGL01767:Kndc1 APN 7 139,509,959 (GRCm39) missense probably damaging 1.00
IGL01884:Kndc1 APN 7 139,494,110 (GRCm39) missense probably damaging 1.00
IGL01932:Kndc1 APN 7 139,503,705 (GRCm39) missense probably damaging 0.98
IGL02133:Kndc1 APN 7 139,500,683 (GRCm39) missense probably benign 0.19
IGL02411:Kndc1 APN 7 139,501,829 (GRCm39) critical splice donor site probably null
IGL02472:Kndc1 APN 7 139,490,817 (GRCm39) missense probably benign 0.01
IGL02537:Kndc1 APN 7 139,490,326 (GRCm39) missense probably benign 0.01
IGL02708:Kndc1 APN 7 139,481,097 (GRCm39) missense probably damaging 1.00
IGL03115:Kndc1 APN 7 139,501,425 (GRCm39) missense probably benign 0.28
IGL03160:Kndc1 APN 7 139,500,605 (GRCm39) nonsense probably null
IGL03138:Kndc1 UTSW 7 139,519,791 (GRCm39) missense possibly damaging 0.89
PIT4142001:Kndc1 UTSW 7 139,503,692 (GRCm39) frame shift probably null
PIT4696001:Kndc1 UTSW 7 139,512,830 (GRCm39) missense probably damaging 1.00
R0349:Kndc1 UTSW 7 139,490,220 (GRCm39) missense probably benign 0.00
R0384:Kndc1 UTSW 7 139,490,515 (GRCm39) missense possibly damaging 0.85
R0415:Kndc1 UTSW 7 139,510,037 (GRCm39) missense probably damaging 1.00
R0421:Kndc1 UTSW 7 139,488,912 (GRCm39) missense probably damaging 1.00
R0487:Kndc1 UTSW 7 139,493,939 (GRCm39) missense probably null 0.19
R0530:Kndc1 UTSW 7 139,481,153 (GRCm39) missense probably damaging 1.00
R0905:Kndc1 UTSW 7 139,503,651 (GRCm39) missense possibly damaging 0.94
R1434:Kndc1 UTSW 7 139,502,600 (GRCm39) missense probably damaging 1.00
R1608:Kndc1 UTSW 7 139,507,321 (GRCm39) missense possibly damaging 0.80
R1644:Kndc1 UTSW 7 139,510,669 (GRCm39) missense probably damaging 1.00
R1835:Kndc1 UTSW 7 139,507,624 (GRCm39) missense probably damaging 0.99
R2012:Kndc1 UTSW 7 139,501,196 (GRCm39) missense possibly damaging 0.90
R2102:Kndc1 UTSW 7 139,510,674 (GRCm39) missense probably benign 0.02
R2103:Kndc1 UTSW 7 139,501,150 (GRCm39) missense probably benign 0.01
R2128:Kndc1 UTSW 7 139,510,025 (GRCm39) missense probably damaging 1.00
R2516:Kndc1 UTSW 7 139,501,738 (GRCm39) missense probably damaging 1.00
R3030:Kndc1 UTSW 7 139,481,123 (GRCm39) missense probably damaging 1.00
R3617:Kndc1 UTSW 7 139,481,976 (GRCm39) splice site probably benign
R3747:Kndc1 UTSW 7 139,507,817 (GRCm39) critical splice donor site probably null
R3848:Kndc1 UTSW 7 139,488,893 (GRCm39) missense probably damaging 1.00
R4028:Kndc1 UTSW 7 139,509,941 (GRCm39) missense probably damaging 0.98
R4043:Kndc1 UTSW 7 139,504,044 (GRCm39) missense probably benign 0.06
R4044:Kndc1 UTSW 7 139,504,044 (GRCm39) missense probably benign 0.06
R4095:Kndc1 UTSW 7 139,516,938 (GRCm39) missense possibly damaging 0.49
R4289:Kndc1 UTSW 7 139,490,798 (GRCm39) missense probably benign 0.01
R4478:Kndc1 UTSW 7 139,500,600 (GRCm39) missense probably damaging 1.00
R4514:Kndc1 UTSW 7 139,490,202 (GRCm39) missense probably benign 0.00
R4540:Kndc1 UTSW 7 139,501,343 (GRCm39) nonsense probably null
R4584:Kndc1 UTSW 7 139,481,159 (GRCm39) missense probably damaging 1.00
R4693:Kndc1 UTSW 7 139,501,695 (GRCm39) missense probably benign 0.02
R4705:Kndc1 UTSW 7 139,510,036 (GRCm39) missense possibly damaging 0.81
R4773:Kndc1 UTSW 7 139,503,946 (GRCm39) nonsense probably null
R4859:Kndc1 UTSW 7 139,501,821 (GRCm39) missense probably benign 0.03
R5004:Kndc1 UTSW 7 139,512,792 (GRCm39) nonsense probably null
R5037:Kndc1 UTSW 7 139,490,371 (GRCm39) missense possibly damaging 0.52
R5322:Kndc1 UTSW 7 139,516,722 (GRCm39) missense probably damaging 1.00
R5428:Kndc1 UTSW 7 139,488,878 (GRCm39) missense probably damaging 0.99
R5503:Kndc1 UTSW 7 139,511,802 (GRCm39) missense probably damaging 1.00
R5506:Kndc1 UTSW 7 139,507,804 (GRCm39) missense probably damaging 1.00
R5525:Kndc1 UTSW 7 139,504,026 (GRCm39) missense probably benign 0.00
R5888:Kndc1 UTSW 7 139,475,133 (GRCm39) missense probably benign 0.00
R5942:Kndc1 UTSW 7 139,516,792 (GRCm39) missense probably damaging 1.00
R5979:Kndc1 UTSW 7 139,519,740 (GRCm39) missense probably benign 0.05
R5990:Kndc1 UTSW 7 139,507,333 (GRCm39) missense probably damaging 0.99
R6038:Kndc1 UTSW 7 139,503,691 (GRCm39) frame shift probably null
R6076:Kndc1 UTSW 7 139,481,954 (GRCm39) missense probably damaging 1.00
R6118:Kndc1 UTSW 7 139,503,717 (GRCm39) missense probably damaging 1.00
R6151:Kndc1 UTSW 7 139,501,129 (GRCm39) missense probably benign 0.04
R6276:Kndc1 UTSW 7 139,500,979 (GRCm39) missense probably benign
R6367:Kndc1 UTSW 7 139,493,422 (GRCm39) missense probably damaging 1.00
R6726:Kndc1 UTSW 7 139,502,667 (GRCm39) critical splice donor site probably null
R6745:Kndc1 UTSW 7 139,500,892 (GRCm39) missense probably benign 0.02
R6886:Kndc1 UTSW 7 139,493,485 (GRCm39) missense probably benign 0.01
R6912:Kndc1 UTSW 7 139,490,194 (GRCm39) missense probably damaging 0.99
R7070:Kndc1 UTSW 7 139,501,744 (GRCm39) missense probably damaging 1.00
R7123:Kndc1 UTSW 7 139,516,749 (GRCm39) missense probably damaging 0.99
R7158:Kndc1 UTSW 7 139,511,773 (GRCm39) missense possibly damaging 0.48
R7248:Kndc1 UTSW 7 139,500,699 (GRCm39) missense probably damaging 1.00
R7437:Kndc1 UTSW 7 139,488,959 (GRCm39) missense probably damaging 1.00
R7564:Kndc1 UTSW 7 139,500,612 (GRCm39) missense probably benign 0.01
R7570:Kndc1 UTSW 7 139,503,691 (GRCm39) frame shift probably null
R7625:Kndc1 UTSW 7 139,517,930 (GRCm39) missense possibly damaging 0.90
R7629:Kndc1 UTSW 7 139,475,176 (GRCm39) missense probably damaging 1.00
R7726:Kndc1 UTSW 7 139,519,751 (GRCm39) missense possibly damaging 0.67
R7840:Kndc1 UTSW 7 139,503,731 (GRCm39) missense probably damaging 1.00
R7859:Kndc1 UTSW 7 139,500,880 (GRCm39) missense possibly damaging 0.57
R7934:Kndc1 UTSW 7 139,501,402 (GRCm39) missense probably benign 0.02
R8011:Kndc1 UTSW 7 139,490,536 (GRCm39) missense possibly damaging 0.90
R8062:Kndc1 UTSW 7 139,498,760 (GRCm39) missense probably benign 0.01
R8134:Kndc1 UTSW 7 139,481,285 (GRCm39) splice site probably null
R8197:Kndc1 UTSW 7 139,493,447 (GRCm39) missense probably damaging 1.00
R8350:Kndc1 UTSW 7 139,503,960 (GRCm39) missense probably damaging 1.00
R8399:Kndc1 UTSW 7 139,493,434 (GRCm39) missense probably damaging 1.00
R8400:Kndc1 UTSW 7 139,493,434 (GRCm39) missense probably damaging 1.00
R8447:Kndc1 UTSW 7 139,481,121 (GRCm39) missense probably damaging 1.00
R8534:Kndc1 UTSW 7 139,503,669 (GRCm39) missense probably benign 0.27
R8735:Kndc1 UTSW 7 139,490,130 (GRCm39) missense probably benign 0.00
R8816:Kndc1 UTSW 7 139,517,909 (GRCm39) missense probably damaging 1.00
R8883:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R8899:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R8961:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R8961:Kndc1 UTSW 7 139,503,976 (GRCm39) missense possibly damaging 0.95
R9002:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9010:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9065:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9066:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9223:Kndc1 UTSW 7 139,501,357 (GRCm39) missense possibly damaging 0.89
R9230:Kndc1 UTSW 7 139,500,600 (GRCm39) missense probably damaging 1.00
R9291:Kndc1 UTSW 7 139,475,140 (GRCm39) missense possibly damaging 0.55
R9441:Kndc1 UTSW 7 139,501,392 (GRCm39) missense probably damaging 0.99
R9510:Kndc1 UTSW 7 139,510,031 (GRCm39) missense probably benign 0.00
R9518:Kndc1 UTSW 7 139,519,827 (GRCm39) missense probably damaging 1.00
R9758:Kndc1 UTSW 7 139,500,620 (GRCm39) missense possibly damaging 0.71
Z1177:Kndc1 UTSW 7 139,501,828 (GRCm39) missense possibly damaging 0.63
Z1186:Kndc1 UTSW 7 139,490,729 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACTTAGAATCACAGGCACGC -3'
(R):5'- CCCTGCTTTCTTGAGGAAGG -3'

Sequencing Primer
(F):5'- AGGCACGCTCACTCATTG -3'
(R):5'- AAGCAGTAAGGGCCCTTCCAG -3'
Posted On 2022-06-15