Mutagenetix > Incidental Mutation

Incidental Mutation 'R9476:Csmd1'

715784

Institutional Source

Beutler Lab

Gene Symbol

Csmd1

Ensembl Gene

ENSMUSG00000060924

Gene Name

CUB and Sushi multiple domains 1

Synonyms

MMRRC Submission

Accession Numbers

Genbank: NM_053171.2

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9476 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

15892537-17535586 bp(-) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

T to A at 15931215 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000080751 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082104]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000082104

SMART Domains

Protein: ENSMUSP00000080751
Gene: ENSMUSG00000060924

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
CUB	32	140	1.46e-26	SMART
CCP	145	202	1.01e-11	SMART
CUB	208	312	1.05e-27	SMART
CCP	349	406	1.28e-8	SMART
CUB	411	522	2.34e-25	SMART
CCP	527	580	1.22e-14	SMART
CUB	584	692	1.61e-37	SMART
CCP	697	754	4.41e-12	SMART
CUB	758	866	6.55e-38	SMART
CCP	873	926	2.53e-12	SMART
CUB	930	1040	8.94e-22	SMART
CCP	1045	1100	7.06e-11	SMART
CUB	1104	1212	3.14e-26	SMART
CCP	1217	1273	1.18e-12	SMART
CUB	1277	1386	9.72e-32	SMART
CCP	1391	1447	2.06e-12	SMART
CUB	1451	1559	1.68e-35	SMART
CCP	1564	1621	2.53e-12	SMART
CUB	1625	1733	4.24e-14	SMART
CCP	1741	1798	9.46e-12	SMART
CUB	1802	1910	4.23e-32	SMART
CCP	1915	1970	8.23e-12	SMART
CUB	1974	2082	8.59e-33	SMART
CCP	2087	2142	6.09e-15	SMART
CUB	2146	2253	2.36e-30	SMART
CCP	2258	2315	1.1e-12	SMART
CUB	2320	2430	4.3e-24	SMART
CCP	2432	2490	2.94e-8	SMART
CCP	2495	2552	2.03e-11	SMART
CCP	2557	2617	1.22e-5	SMART
CCP	2622	2675	2.72e-12	SMART
CCP	2680	2733	5.86e-17	SMART
CCP	2738	2791	6.09e-15	SMART
CCP	2796	2854	9.1e-14	SMART
CCP	2859	2912	3.96e-14	SMART
CCP	2920	2973	4.41e-12	SMART
CCP	2978	3032	2.94e-8	SMART
CCP	3037	3092	6.59e-11	SMART
CCP	3097	3150	4.12e-12	SMART
CCP	3155	3208	7.92e-14	SMART
CCP	3216	3270	2.8e-14	SMART
CCP	3275	3330	3.78e-11	SMART
transmembrane domain	3487	3509	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice exhibit normal pre-pulse inhibition, social interaction, sucrose preference and d-amphetamine sensitivity. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930578G10Rik	T	G	4: 42,760,998	W6G	unknown	Het
Aatk	A	T	11: 120,010,268	C1101S	probably benign	Het
Abcb4	A	T	5: 8,927,790	D456V	probably damaging	Het
Abcc8	T	C	7: 46,169,846	E186G	possibly damaging	Het
Adam18	T	C	8: 24,625,791	N629S	probably benign	Het
Angpt2	T	G	8: 18,714,127	N133T	probably benign	Het
Ankrd13c	T	A	3: 157,991,759	S334T	probably benign	Het
Ankrd13d	A	T	19: 4,270,261	S151T	unknown	Het
Ap3d1	G	A	10: 80,709,821	P1025S	probably benign	Het
Bhlhe41	G	A	6: 145,863,222	A288V	possibly damaging	Het
Cacna1b	T	C	2: 24,650,046	E1467G	probably damaging	Het
Cacna1h	T	A	17: 25,392,550	T425S	probably damaging	Het
Cdk13	A	C	13: 17,728,162	C934W	probably damaging	Het
Ces1b	T	A	8: 93,073,262	N162I	probably damaging	Het
Clec9a	T	A	6: 129,421,060	I187K	possibly damaging	Het
Cpsf3	A	G	12: 21,300,079	I266M	probably damaging	Het
Cr2	G	T	1: 195,158,108	L509M	probably damaging	Het
Creb3l2	C	A	6: 37,334,511	G448W	probably damaging	Het
Cul9	G	A	17: 46,510,907	R1881W	probably damaging	Het
Cyth1	C	T	11: 118,185,380		probably null	Het
Dnhd1	A	T	7: 105,703,682	N2681Y	possibly damaging	Het
Dnm1	T	C	2: 32,323,727	M476V	probably benign	Het
Dnmt3a	A	G	12: 3,907,707	H896R	probably damaging	Het
Dock1	T	G	7: 134,990,550	I938S	probably benign	Het
Dock6	G	A	9: 21,813,525	L1515F	probably damaging	Het
Dusp16	T	C	6: 134,718,263	H535R	probably benign	Het
Fancd2os	T	A	6: 113,598,033	Y4F	probably damaging	Het
Fat4	A	T	3: 38,983,737	Q3846L	probably benign	Het
Fbxw10	A	C	11: 62,852,988	H240P	probably benign	Het
Frmd4a	A	G	2: 4,603,513	T731A	probably benign	Het
Gm44501	T	A	17: 40,578,929	H111Q	possibly damaging	Het
Gm8765	A	G	13: 50,702,113	T596A	possibly damaging	Het
Gsdmc	T	C	15: 63,778,702	M277V	probably benign	Het
Hira	A	G	16: 18,954,039	D867G	probably damaging	Het
Hmcn1	A	G	1: 150,586,376	S5184P	probably benign	Het
Ighv1-26	A	C	12: 114,788,787	F7V	probably benign	Het
Igkv4-81	C	T	6: 68,990,812	E102K	possibly damaging	Het
Inmt	G	T	6: 55,171,005	S213Y	possibly damaging	Het
Ints2	T	A	11: 86,244,509	M360L	probably benign	Het
Itih3	A	G	14: 30,909,459	S827P	probably benign	Het
Itpr3	G	A	17: 27,118,677		probably benign	Het
Kcnk12	C	A	17: 87,746,694	R180L	probably benign	Het
Kndc1	G	A	7: 139,930,118	S1291N	probably benign	Het
Mettl21a	T	C	1: 64,608,126	T91A	probably damaging	Het
Mmrn2	A	G	14: 34,398,450	I426V	possibly damaging	Het
Mrpl21	T	G	19: 3,287,704	V137G	probably damaging	Het
Nrbp2	T	C	15: 76,089,777	N218S	probably damaging	Het
Nrip1	T	C	16: 76,292,932	N579S	probably benign	Het
Nsf	T	C	11: 103,873,162	N365S	probably damaging	Het
Olfr774	A	G	10: 129,238,787	I213V	probably damaging	Het
Olfr846	A	T	9: 19,361,087	D89E	probably benign	Het
Osbpl3	C	T	6: 50,336,214		probably null	Het
Oscar	T	A	7: 3,611,844	H43L	probably benign	Het
Pam	C	T	1: 97,898,340		probably null	Het
Parn	A	T	16: 13,541,078	M600K	probably benign	Het
Pcdha11	C	A	18: 37,006,479	T387N	probably benign	Het
Plce1	G	A	19: 38,777,893	E2121K	possibly damaging	Het
Prune2	T	A	19: 17,119,342	Y737N	possibly damaging	Het
Ptch1	G	A	13: 63,533,634	P613L	probably benign	Het
Ptprt	A	C	2: 161,555,461	C1129G	probably damaging	Het
Rara	C	T	11: 98,970,157	S157L	probably benign	Het
Rest	T	A	5: 77,268,251	M104K	probably damaging	Het
Rfc1	A	G	5: 65,279,799	S513P	probably damaging	Het
Rnf40	T	A	7: 127,602,636	I1000N	probably damaging	Het
Scube2	C	T	7: 109,831,762	G410E	probably damaging	Het
Sh3gl2	A	G	4: 85,385,852	E264G	probably benign	Het
Shank1	G	A	7: 44,312,918	S71N	unknown	Het
Smc4	T	G	3: 69,007,329	S92A	probably damaging	Het
Spata31d1b	A	G	13: 59,715,653	D205G	probably benign	Het
Spef2	T	C	15: 9,713,117	R390G	probably damaging	Het
Speg	T	C	1: 75,401,124	F842S	probably damaging	Het
Stk17b	G	T	1: 53,757,739	H290N	probably damaging	Het
Stpg3	A	T	2: 25,213,504	V191D	probably benign	Het
Supt6	C	T	11: 78,229,464	R350H	probably damaging	Het
Tet3	T	C	6: 83,403,953	E411G	possibly damaging	Het
Tet3	T	A	6: 83,404,826		probably null	Het
Tns3	A	G	11: 8,445,702	I1234T	probably damaging	Het
Trim34b	A	G	7: 104,331,296	E197G	probably damaging	Het
Vcan	G	T	13: 89,703,412	T1143K	possibly damaging	Het
Vmn2r61	T	A	7: 42,300,169	V671E	probably damaging	Het
Wdtc1	A	G	4: 133,322,218	V29A	probably damaging	Het
Zfp462	G	A	4: 55,080,735	M2450I	probably benign	Het
Zfp869	A	T	8: 69,707,199	C241*	probably null	Het

Other mutations in Csmd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Csmd1	APN	8	16009297	splice site	probably benign
IGL00433:Csmd1	APN	8	16231373	missense	probably damaging	1.00
IGL00500:Csmd1	APN	8	15921139	missense	probably damaging	1.00
IGL00666:Csmd1	APN	8	16189990	missense	probably damaging	1.00
IGL00913:Csmd1	APN	8	16071287	missense	probably benign	0.00
IGL01012:Csmd1	APN	8	15917341	missense	probably benign	0.00
IGL01123:Csmd1	APN	8	17534928	missense	possibly damaging	0.96
IGL01348:Csmd1	APN	8	15910596	missense	probably damaging	0.99
IGL01444:Csmd1	APN	8	16200055	missense	probably benign	0.00
IGL01530:Csmd1	APN	8	15903195	missense	probably damaging	0.99
IGL01548:Csmd1	APN	8	16288646	nonsense	probably null
IGL01814:Csmd1	APN	8	16501375	missense	probably damaging	1.00
IGL01889:Csmd1	APN	8	15998857	missense	probably damaging	1.00
IGL02055:Csmd1	APN	8	16069001	missense	probably damaging	0.99
IGL02066:Csmd1	APN	8	15926594	missense	probably damaging	1.00
IGL02097:Csmd1	APN	8	16211759	missense	probably null	0.17
IGL02112:Csmd1	APN	8	16081705	missense	probably benign	0.18
IGL02161:Csmd1	APN	8	16358412	missense	probably damaging	0.97
IGL02189:Csmd1	APN	8	16271606	missense	probably damaging	0.99
IGL02272:Csmd1	APN	8	16199893	missense	probably damaging	0.99
IGL02292:Csmd1	APN	8	16211870	missense	probably damaging	1.00
IGL02385:Csmd1	APN	8	15903275	missense	probably benign	0.08
IGL02424:Csmd1	APN	8	16092326	missense	probably benign	0.22
IGL02492:Csmd1	APN	8	16002597	missense	probably benign	0.13
IGL02507:Csmd1	APN	8	17534976	utr 5 prime	probably benign
IGL02513:Csmd1	APN	8	15999869	splice site	probably benign
IGL02727:Csmd1	APN	8	16231327	missense	probably damaging	1.00
IGL02728:Csmd1	APN	8	15999779	critical splice donor site	probably null
IGL02852:Csmd1	APN	8	15895728	missense	probably damaging	0.99
IGL02935:Csmd1	APN	8	16223334	missense	probably damaging	1.00
IGL02945:Csmd1	APN	8	16271570	missense	possibly damaging	0.92
IGL02959:Csmd1	APN	8	15910465	missense	probably damaging	0.99
IGL03113:Csmd1	APN	8	16028698	missense	probably benign
IGL03129:Csmd1	APN	8	15961521	missense	probably damaging	0.99
IGL03131:Csmd1	APN	8	16088217	missense	probably damaging	1.00
IGL03275:Csmd1	APN	8	16157092	missense	probably benign	0.00
IGL03297:Csmd1	APN	8	16009432	nonsense	probably null
ikura	UTSW	8	16231271	missense	probably damaging	1.00
I2289:Csmd1	UTSW	8	15912381	missense	probably benign	0.10
IGL03055:Csmd1	UTSW	8	16095501	missense	probably damaging	1.00
IGL03097:Csmd1	UTSW	8	15945127	missense	probably damaging	1.00
PIT4260001:Csmd1	UTSW	8	16070313	missense	probably damaging	1.00
PIT4378001:Csmd1	UTSW	8	15895728	missense	probably damaging	0.99
PIT4520001:Csmd1	UTSW	8	15906023	missense	probably benign	0.01
R0037:Csmd1	UTSW	8	15917248	missense	probably damaging	0.97
R0095:Csmd1	UTSW	8	16233051	missense	probably damaging	1.00
R0113:Csmd1	UTSW	8	15984849	missense	probably damaging	1.00
R0129:Csmd1	UTSW	8	16079942	missense	possibly damaging	0.95
R0144:Csmd1	UTSW	8	16391824	missense	probably benign	0.16
R0166:Csmd1	UTSW	8	16233022	missense	probably benign	0.29
R0227:Csmd1	UTSW	8	16391822	missense	probably benign	0.05
R0279:Csmd1	UTSW	8	16223235	missense	probably damaging	0.99
R0280:Csmd1	UTSW	8	16271602	missense	probably damaging	1.00
R0312:Csmd1	UTSW	8	15984760	missense	probably damaging	1.00
R0355:Csmd1	UTSW	8	15918330	missense	probably damaging	0.97
R0367:Csmd1	UTSW	8	15917270	missense	probably damaging	1.00
R0395:Csmd1	UTSW	8	16346638	missense	probably damaging	0.99
R0413:Csmd1	UTSW	8	16710514	missense	probably damaging	0.97
R0457:Csmd1	UTSW	8	16501393	critical splice acceptor site	probably null
R0463:Csmd1	UTSW	8	15921759	missense	probably damaging	0.99
R0482:Csmd1	UTSW	8	16233101	missense	probably damaging	1.00
R0501:Csmd1	UTSW	8	17027323	missense	probably damaging	0.97
R0505:Csmd1	UTSW	8	15992758	missense	probably damaging	1.00
R0507:Csmd1	UTSW	8	16185344	splice site	probably benign
R0511:Csmd1	UTSW	8	15932529	missense	possibly damaging	0.80
R0555:Csmd1	UTSW	8	16185273	missense	probably benign
R0580:Csmd1	UTSW	8	15910528	missense	probably damaging	1.00
R0610:Csmd1	UTSW	8	15918208	missense	possibly damaging	0.95
R0634:Csmd1	UTSW	8	16226391	missense	probably damaging	1.00
R0666:Csmd1	UTSW	8	16069049	missense	possibly damaging	0.88
R0674:Csmd1	UTSW	8	16000550	missense	probably benign	0.03
R0675:Csmd1	UTSW	8	16158131	missense	probably benign	0.01
R0763:Csmd1	UTSW	8	17027284	missense	possibly damaging	0.67
R0781:Csmd1	UTSW	8	15921174	missense	probably benign	0.35
R0862:Csmd1	UTSW	8	16190026	missense	probably damaging	0.99
R0864:Csmd1	UTSW	8	16190026	missense	probably damaging	0.99
R0925:Csmd1	UTSW	8	16710618	missense	probably benign	0.29
R0926:Csmd1	UTSW	8	16033576	splice site	probably null
R1005:Csmd1	UTSW	8	16288693	missense	probably damaging	0.99
R1073:Csmd1	UTSW	8	16358463	splice site	probably benign
R1185:Csmd1	UTSW	8	16358348	missense	probably damaging	0.96
R1185:Csmd1	UTSW	8	16358348	missense	probably damaging	0.96
R1185:Csmd1	UTSW	8	16358348	missense	probably damaging	0.96
R1256:Csmd1	UTSW	8	16079964	missense	probably damaging	1.00
R1294:Csmd1	UTSW	8	16698036	missense	probably damaging	0.99
R1375:Csmd1	UTSW	8	16463081	splice site	probably null
R1447:Csmd1	UTSW	8	15925306	nonsense	probably null
R1450:Csmd1	UTSW	8	15945180	critical splice acceptor site	probably null
R1470:Csmd1	UTSW	8	16157204	splice site	probably benign
R1580:Csmd1	UTSW	8	15925299	missense	probably damaging	1.00
R1591:Csmd1	UTSW	8	15900710	missense	probably damaging	0.99
R1658:Csmd1	UTSW	8	16081725	missense	possibly damaging	0.69
R1678:Csmd1	UTSW	8	15918252	missense	possibly damaging	0.58
R1717:Csmd1	UTSW	8	17216692	missense	possibly damaging	0.58
R1735:Csmd1	UTSW	8	15932610	missense	probably damaging	0.99
R1750:Csmd1	UTSW	8	15917303	missense	probably damaging	0.99
R1753:Csmd1	UTSW	8	16157120	nonsense	probably null
R1822:Csmd1	UTSW	8	16223326	missense	probably damaging	1.00
R1875:Csmd1	UTSW	8	15929101	missense	probably damaging	0.99
R1909:Csmd1	UTSW	8	15906116	missense	probably damaging	1.00
R1912:Csmd1	UTSW	8	16233998	critical splice donor site	probably null
R1993:Csmd1	UTSW	8	16346684	missense	probably damaging	0.99
R2067:Csmd1	UTSW	8	15900782	missense	probably benign
R2094:Csmd1	UTSW	8	16079978	missense	probably damaging	0.99
R2119:Csmd1	UTSW	8	17216733	missense	probably damaging	0.98
R2127:Csmd1	UTSW	8	15917392	missense	probably damaging	1.00
R2138:Csmd1	UTSW	8	15929088	missense	probably damaging	0.96
R2216:Csmd1	UTSW	8	17027339	critical splice acceptor site	probably null
R2220:Csmd1	UTSW	8	15992641	missense	possibly damaging	0.94
R2380:Csmd1	UTSW	8	16190087	missense	probably damaging	1.00
R2471:Csmd1	UTSW	8	16211762	missense	probably damaging	1.00
R2984:Csmd1	UTSW	8	15953782	missense	probably damaging	1.00
R3001:Csmd1	UTSW	8	16196170	missense	probably damaging	0.98
R3002:Csmd1	UTSW	8	16196170	missense	probably damaging	0.98
R3003:Csmd1	UTSW	8	16196170	missense	probably damaging	0.98
R3103:Csmd1	UTSW	8	15917405	missense	probably damaging	1.00
R3104:Csmd1	UTSW	8	17027231	missense	probably damaging	1.00
R3620:Csmd1	UTSW	8	15992684	missense	probably benign	0.29
R3621:Csmd1	UTSW	8	15992684	missense	probably benign	0.29
R3748:Csmd1	UTSW	8	15906071	missense	probably damaging	0.99
R3780:Csmd1	UTSW	8	16201986	missense	probably damaging	1.00
R3815:Csmd1	UTSW	8	16002522	missense	probably damaging	1.00
R3816:Csmd1	UTSW	8	16002522	missense	probably damaging	1.00
R3818:Csmd1	UTSW	8	16002522	missense	probably damaging	1.00
R3819:Csmd1	UTSW	8	16002522	missense	probably damaging	1.00
R3850:Csmd1	UTSW	8	16079922	missense	probably benign	0.00
R3945:Csmd1	UTSW	8	15910619	splice site	probably null
R3980:Csmd1	UTSW	8	15906056	nonsense	probably null
R4061:Csmd1	UTSW	8	15945158	missense	probably benign	0.00
R4086:Csmd1	UTSW	8	15992738	missense	probably damaging	0.99
R4087:Csmd1	UTSW	8	15992738	missense	probably damaging	0.99
R4089:Csmd1	UTSW	8	15992738	missense	probably damaging	0.99
R4183:Csmd1	UTSW	8	15910464	missense	probably damaging	0.99
R4226:Csmd1	UTSW	8	16000490	missense	probably damaging	0.99
R4454:Csmd1	UTSW	8	15945011	missense	probably damaging	0.99
R4533:Csmd1	UTSW	8	15931037	splice site	probably null
R4544:Csmd1	UTSW	8	16710636	missense	possibly damaging	0.93
R4547:Csmd1	UTSW	8	16391797	missense	possibly damaging	0.48
R4612:Csmd1	UTSW	8	15921908	splice site	probably null
R4620:Csmd1	UTSW	8	16002694	critical splice acceptor site	probably null
R4627:Csmd1	UTSW	8	16697917	missense	probably benign	0.00
R4633:Csmd1	UTSW	8	16002620	missense	probably damaging	0.99
R4646:Csmd1	UTSW	8	15932511	missense	possibly damaging	0.87
R4648:Csmd1	UTSW	8	15998788	nonsense	probably null
R4668:Csmd1	UTSW	8	16023891	missense	possibly damaging	0.50
R4709:Csmd1	UTSW	8	16023891	missense	possibly damaging	0.96
R4709:Csmd1	UTSW	8	16710506	critical splice donor site	probably null
R4741:Csmd1	UTSW	8	15910447	missense	probably damaging	0.99
R4774:Csmd1	UTSW	8	16009369	missense	probably benign	0.11
R4793:Csmd1	UTSW	8	16088263	missense	probably damaging	1.00
R4829:Csmd1	UTSW	8	16127296	missense	probably damaging	1.00
R4888:Csmd1	UTSW	8	15895674	utr 3 prime	probably benign
R4896:Csmd1	UTSW	8	16009439	missense	probably benign	0.00
R4932:Csmd1	UTSW	8	16023765	missense	probably damaging	0.99
R4944:Csmd1	UTSW	8	15998772	missense	probably damaging	1.00
R4953:Csmd1	UTSW	8	16199917	missense	probably damaging	0.99
R4996:Csmd1	UTSW	8	15910452	missense	probably damaging	0.97
R5028:Csmd1	UTSW	8	15989090	missense	probably damaging	1.00
R5146:Csmd1	UTSW	8	16196190	missense	probably damaging	1.00
R5272:Csmd1	UTSW	8	16199944	missense	probably damaging	0.99
R5327:Csmd1	UTSW	8	17216712	missense	possibly damaging	0.94
R5399:Csmd1	UTSW	8	16710597	missense	probably damaging	1.00
R5411:Csmd1	UTSW	8	15910471	missense	probably damaging	1.00
R5462:Csmd1	UTSW	8	15961486	missense	probably benign	0.12
R5463:Csmd1	UTSW	8	15984860	missense	probably benign	0.34
R5497:Csmd1	UTSW	8	16085181	missense	probably benign	0.20
R5536:Csmd1	UTSW	8	16288660	missense	probably damaging	0.99
R5711:Csmd1	UTSW	8	15953703	missense	probably damaging	1.00
R5730:Csmd1	UTSW	8	16185192	nonsense	probably null
R5788:Csmd1	UTSW	8	16201966	missense	probably damaging	1.00
R5941:Csmd1	UTSW	8	15932471	missense	probably damaging	0.99
R5960:Csmd1	UTSW	8	16071416	missense	possibly damaging	0.68
R5961:Csmd1	UTSW	8	16070352	missense	probably damaging	0.99
R5969:Csmd1	UTSW	8	16071353	missense	probably benign	0.00
R5998:Csmd1	UTSW	8	15910443	missense	probably damaging	1.00
R6062:Csmd1	UTSW	8	16092305	missense	possibly damaging	0.68
R6109:Csmd1	UTSW	8	16199860	missense	possibly damaging	0.93
R6116:Csmd1	UTSW	8	16211850	missense	probably damaging	1.00
R6143:Csmd1	UTSW	8	16088301	missense	probably damaging	1.00
R6155:Csmd1	UTSW	8	15903231	missense	probably benign	0.01
R6197:Csmd1	UTSW	8	15926611	missense	probably benign	0.32
R6247:Csmd1	UTSW	8	16196235	missense	possibly damaging	0.91
R6304:Csmd1	UTSW	8	16058674	missense	probably damaging	1.00
R6317:Csmd1	UTSW	8	16710642	missense	possibly damaging	0.89
R6318:Csmd1	UTSW	8	15903212	missense	probably damaging	1.00
R6338:Csmd1	UTSW	8	15932492	missense	possibly damaging	0.75
R6369:Csmd1	UTSW	8	17535004	start gained	probably benign
R6447:Csmd1	UTSW	8	15910527	missense	probably damaging	1.00
R6454:Csmd1	UTSW	8	15921150	missense	probably damaging	0.99
R6494:Csmd1	UTSW	8	16211695	splice site	probably null
R6614:Csmd1	UTSW	8	17216787	missense	probably damaging	1.00
R6736:Csmd1	UTSW	8	16002626	missense	probably damaging	0.99
R6769:Csmd1	UTSW	8	16071394	missense	possibly damaging	0.80
R6771:Csmd1	UTSW	8	16071394	missense	possibly damaging	0.80
R6804:Csmd1	UTSW	8	16037246	missense	probably damaging	1.00
R6818:Csmd1	UTSW	8	16185327	missense	probably damaging	1.00
R6863:Csmd1	UTSW	8	17534913	missense	possibly damaging	0.85
R6930:Csmd1	UTSW	8	16092395	missense	probably damaging	0.97
R6969:Csmd1	UTSW	8	17216789	missense	possibly damaging	0.94
R7112:Csmd1	UTSW	8	16101128	missense	probably damaging	1.00
R7124:Csmd1	UTSW	8	15903202	missense	probably damaging	1.00
R7167:Csmd1	UTSW	8	15926524	missense	probably benign
R7243:Csmd1	UTSW	8	15915357	missense	probably damaging	1.00
R7260:Csmd1	UTSW	8	16000574	missense	probably damaging	1.00
R7271:Csmd1	UTSW	8	17027279	missense	probably damaging	0.99
R7324:Csmd1	UTSW	8	16058707	missense	probably damaging	1.00
R7325:Csmd1	UTSW	8	16058707	missense	probably damaging	1.00
R7327:Csmd1	UTSW	8	16058707	missense	probably damaging	1.00
R7373:Csmd1	UTSW	8	15992713	missense	probably damaging	1.00
R7406:Csmd1	UTSW	8	16288693	missense	probably damaging	0.99
R7427:Csmd1	UTSW	8	16023850	missense	possibly damaging	0.91
R7428:Csmd1	UTSW	8	16023850	missense	possibly damaging	0.91
R7445:Csmd1	UTSW	8	16158254	missense	possibly damaging	0.61
R7458:Csmd1	UTSW	8	15953738	missense	probably damaging	1.00
R7476:Csmd1	UTSW	8	15895731	missense	probably damaging	1.00
R7527:Csmd1	UTSW	8	16211718	missense	probably damaging	1.00
R7544:Csmd1	UTSW	8	16092296	missense	probably damaging	1.00
R7583:Csmd1	UTSW	8	15998833	missense	probably damaging	0.96
R7603:Csmd1	UTSW	8	16288682	missense	probably damaging	1.00
R7607:Csmd1	UTSW	8	15918331	missense	possibly damaging	0.94
R7642:Csmd1	UTSW	8	16085178	missense	probably damaging	0.99
R7669:Csmd1	UTSW	8	15917273	missense	probably damaging	1.00
R7720:Csmd1	UTSW	8	15931108	missense	probably damaging	1.00
R7728:Csmd1	UTSW	8	16231271	missense	probably damaging	1.00
R7738:Csmd1	UTSW	8	16100990	missense	probably damaging	1.00
R7745:Csmd1	UTSW	8	15932461	critical splice donor site	probably null
R7879:Csmd1	UTSW	8	16391806	missense	probably benign	0.28
R7884:Csmd1	UTSW	8	15961418	missense	probably damaging	1.00
R7897:Csmd1	UTSW	8	17534919	missense	possibly damaging	0.96
R8111:Csmd1	UTSW	8	15917306	missense	probably benign
R8119:Csmd1	UTSW	8	17027294	missense	probably damaging	0.99
R8134:Csmd1	UTSW	8	15932550	missense	probably damaging	0.99
R8187:Csmd1	UTSW	8	16127174	missense	probably damaging	0.99
R8196:Csmd1	UTSW	8	16009468	missense	probably benign	0.18
R8231:Csmd1	UTSW	8	16697923	missense	possibly damaging	0.82
R8242:Csmd1	UTSW	8	16710654	missense	probably benign	0.42
R8274:Csmd1	UTSW	8	15910453	missense	possibly damaging	0.93
R8286:Csmd1	UTSW	8	15989188	missense	probably benign	0.18
R8289:Csmd1	UTSW	8	16058702	missense	probably damaging	0.99
R8314:Csmd1	UTSW	8	16158244	missense	probably benign
R8323:Csmd1	UTSW	8	17216735	nonsense	probably null
R8387:Csmd1	UTSW	8	16000484	missense	possibly damaging	0.94
R8413:Csmd1	UTSW	8	15900676	missense	probably damaging	0.98
R8672:Csmd1	UTSW	8	15926598	missense	probably benign	0.01
R8765:Csmd1	UTSW	8	16710611	nonsense	probably null
R8789:Csmd1	UTSW	8	17216706	missense	probably damaging	0.99
R8828:Csmd1	UTSW	8	15998794	missense	probably benign	0.00
R8858:Csmd1	UTSW	8	16070304	missense	probably benign	0.10
R8878:Csmd1	UTSW	8	15910528	missense	probably damaging	1.00
R8911:Csmd1	UTSW	8	16698003	missense	probably damaging	0.99
R8966:Csmd1	UTSW	8	16200045	missense	probably damaging	1.00
R8978:Csmd1	UTSW	8	15921056	missense	probably benign	0.37
R8996:Csmd1	UTSW	8	15921105	missense	possibly damaging	0.54
R9045:Csmd1	UTSW	8	16234074	missense	probably damaging	0.99
R9084:Csmd1	UTSW	8	16088311	missense	probably benign
R9124:Csmd1	UTSW	8	15984806	missense	probably damaging	0.99
R9127:Csmd1	UTSW	8	16223272	missense	probably benign	0.31
R9146:Csmd1	UTSW	8	15998832	missense	probably benign	0.00
R9198:Csmd1	UTSW	8	15912430	missense	probably damaging	1.00
R9285:Csmd1	UTSW	8	15906088	missense	probably damaging	1.00
R9303:Csmd1	UTSW	8	15961532	missense	probably benign	0.31
R9305:Csmd1	UTSW	8	15961532	missense	probably benign	0.31
R9326:Csmd1	UTSW	8	15999803	missense	probably benign	0.21
R9356:Csmd1	UTSW	8	16202055	missense	probably damaging	1.00
R9385:Csmd1	UTSW	8	15984756	missense	probably benign	0.19
R9444:Csmd1	UTSW	8	16158236	missense	probably benign	0.30
R9506:Csmd1	UTSW	8	16200009	missense	probably damaging	1.00
R9614:Csmd1	UTSW	8	16158225	missense	probably benign	0.00
R9668:Csmd1	UTSW	8	16211758	missense	probably benign	0.00
X0011:Csmd1	UTSW	8	16196263	missense	probably damaging	1.00
X0021:Csmd1	UTSW	8	16185256	missense	probably damaging	1.00
X0024:Csmd1	UTSW	8	16037218	missense	probably damaging	0.99
X0028:Csmd1	UTSW	8	15915333	missense	possibly damaging	0.79
Z1088:Csmd1	UTSW	8	15921875	missense	possibly damaging	0.91
Z1088:Csmd1	UTSW	8	16092258	missense	probably damaging	1.00
Z1088:Csmd1	UTSW	8	16189978	missense	possibly damaging	0.50
Z1088:Csmd1	UTSW	8	16200058	missense	probably damaging	0.97
Z1088:Csmd1	UTSW	8	16346617	missense	probably damaging	0.99
Z1176:Csmd1	UTSW	8	15998814	missense	probably damaging	1.00
Z1176:Csmd1	UTSW	8	16037198	missense	probably damaging	1.00
Z1177:Csmd1	UTSW	8	15984708	missense	probably damaging	1.00
Z1177:Csmd1	UTSW	8	16200019	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACCTCGACAGATGGGCAAG -3'
(R):5'- ACAGAATCTCTTGGTGGAAGTC -3'

Sequencing Primer
(F):5'- ATGGGCAAGGGGCTGCTC -3'
(R):5'- CAGAATCTCTTGGTGGAAGTCACTTC -3'

Posted On

2022-06-15