Mutagenetix > Incidental Mutation

Incidental Mutation 'R9476:Tns3'

715793

Institutional Source

Beutler Lab

Gene Symbol

Tns3

Ensembl Gene

ENSMUSG00000020422

Gene Name

tensin 3

Synonyms

TEM6, F830010I22Rik, Tens1

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.328) question?

Stock #

R9476 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

8431652-8664535 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 8445702 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 1234 (I1234T)

Ref Sequence

ENSEMBL: ENSMUSP00000020695 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020695]

AlphaFold

Q5SSZ5

Predicted Effect

probably damaging
Transcript: ENSMUST00000020695
AA Change: I1234T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000020695
Gene: ENSMUSG00000020422
AA Change: I1234T

Domain	Start	End	E-Value	Type
SCOP:d1d5ra2	1	171	5e-28	SMART
PTEN_C2	173	300	1.15e-48	SMART
low complexity region	854	864	N/A	INTRINSIC
low complexity region	1102	1126	N/A	INTRINSIC
SH2	1165	1268	1.32e-18	SMART
PTB	1301	1438	3.14e-24	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit one third postnatal lethality, reduced body weight, growth retardation, smaller digestive tracts with defects in villi and enterocyte differentiation, abnormal lung morphology, and thinner bones with decreased chondrocyte proliferation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930578G10Rik	T	G	4: 42,760,998	W6G	unknown	Het
Aatk	A	T	11: 120,010,268	C1101S	probably benign	Het
Abcb4	A	T	5: 8,927,790	D456V	probably damaging	Het
Abcc8	T	C	7: 46,169,846	E186G	possibly damaging	Het
Adam18	T	C	8: 24,625,791	N629S	probably benign	Het
Angpt2	T	G	8: 18,714,127	N133T	probably benign	Het
Ankrd13c	T	A	3: 157,991,759	S334T	probably benign	Het
Ankrd13d	A	T	19: 4,270,261	S151T	unknown	Het
Ap3d1	G	A	10: 80,709,821	P1025S	probably benign	Het
Bhlhe41	G	A	6: 145,863,222	A288V	possibly damaging	Het
Cacna1b	T	C	2: 24,650,046	E1467G	probably damaging	Het
Cacna1h	T	A	17: 25,392,550	T425S	probably damaging	Het
Cdk13	A	C	13: 17,728,162	C934W	probably damaging	Het
Ces1b	T	A	8: 93,073,262	N162I	probably damaging	Het
Clec9a	T	A	6: 129,421,060	I187K	possibly damaging	Het
Cpsf3	A	G	12: 21,300,079	I266M	probably damaging	Het
Cr2	G	T	1: 195,158,108	L509M	probably damaging	Het
Creb3l2	C	A	6: 37,334,511	G448W	probably damaging	Het
Csmd1	T	A	8: 15,931,215		probably null	Het
Cul9	G	A	17: 46,510,907	R1881W	probably damaging	Het
Cyth1	C	T	11: 118,185,380		probably null	Het
Dnhd1	A	T	7: 105,703,682	N2681Y	possibly damaging	Het
Dnm1	T	C	2: 32,323,727	M476V	probably benign	Het
Dnmt3a	A	G	12: 3,907,707	H896R	probably damaging	Het
Dock1	T	G	7: 134,990,550	I938S	probably benign	Het
Dock6	G	A	9: 21,813,525	L1515F	probably damaging	Het
Dusp16	T	C	6: 134,718,263	H535R	probably benign	Het
Fancd2os	T	A	6: 113,598,033	Y4F	probably damaging	Het
Fat4	A	T	3: 38,983,737	Q3846L	probably benign	Het
Fbxw10	A	C	11: 62,852,988	H240P	probably benign	Het
Frmd4a	A	G	2: 4,603,513	T731A	probably benign	Het
Gm44501	T	A	17: 40,578,929	H111Q	possibly damaging	Het
Gm8765	A	G	13: 50,702,113	T596A	possibly damaging	Het
Gsdmc	T	C	15: 63,778,702	M277V	probably benign	Het
Hira	A	G	16: 18,954,039	D867G	probably damaging	Het
Hmcn1	A	G	1: 150,586,376	S5184P	probably benign	Het
Ighv1-26	A	C	12: 114,788,787	F7V	probably benign	Het
Igkv4-81	C	T	6: 68,990,812	E102K	possibly damaging	Het
Inmt	G	T	6: 55,171,005	S213Y	possibly damaging	Het
Ints2	T	A	11: 86,244,509	M360L	probably benign	Het
Itih3	A	G	14: 30,909,459	S827P	probably benign	Het
Itpr3	G	A	17: 27,118,677		probably benign	Het
Kcnk12	C	A	17: 87,746,694	R180L	probably benign	Het
Kndc1	G	A	7: 139,930,118	S1291N	probably benign	Het
Mettl21a	T	C	1: 64,608,126	T91A	probably damaging	Het
Mmrn2	A	G	14: 34,398,450	I426V	possibly damaging	Het
Mrpl21	T	G	19: 3,287,704	V137G	probably damaging	Het
Nrbp2	T	C	15: 76,089,777	N218S	probably damaging	Het
Nrip1	T	C	16: 76,292,932	N579S	probably benign	Het
Nsf	T	C	11: 103,873,162	N365S	probably damaging	Het
Olfr774	A	G	10: 129,238,787	I213V	probably damaging	Het
Olfr846	A	T	9: 19,361,087	D89E	probably benign	Het
Osbpl3	C	T	6: 50,336,214		probably null	Het
Oscar	T	A	7: 3,611,844	H43L	probably benign	Het
Pam	C	T	1: 97,898,340		probably null	Het
Parn	A	T	16: 13,541,078	M600K	probably benign	Het
Pcdha11	C	A	18: 37,006,479	T387N	probably benign	Het
Plce1	G	A	19: 38,777,893	E2121K	possibly damaging	Het
Prune2	T	A	19: 17,119,342	Y737N	possibly damaging	Het
Ptch1	G	A	13: 63,533,634	P613L	probably benign	Het
Ptprt	A	C	2: 161,555,461	C1129G	probably damaging	Het
Rara	C	T	11: 98,970,157	S157L	probably benign	Het
Rest	T	A	5: 77,268,251	M104K	probably damaging	Het
Rfc1	A	G	5: 65,279,799	S513P	probably damaging	Het
Rnf40	T	A	7: 127,602,636	I1000N	probably damaging	Het
Scube2	C	T	7: 109,831,762	G410E	probably damaging	Het
Sh3gl2	A	G	4: 85,385,852	E264G	probably benign	Het
Shank1	G	A	7: 44,312,918	S71N	unknown	Het
Smc4	T	G	3: 69,007,329	S92A	probably damaging	Het
Spata31d1b	A	G	13: 59,715,653	D205G	probably benign	Het
Spef2	T	C	15: 9,713,117	R390G	probably damaging	Het
Speg	T	C	1: 75,401,124	F842S	probably damaging	Het
Stk17b	G	T	1: 53,757,739	H290N	probably damaging	Het
Stpg3	A	T	2: 25,213,504	V191D	probably benign	Het
Supt6	C	T	11: 78,229,464	R350H	probably damaging	Het
Tet3	T	C	6: 83,403,953	E411G	possibly damaging	Het
Tet3	T	A	6: 83,404,826		probably null	Het
Trim34b	A	G	7: 104,331,296	E197G	probably damaging	Het
Vcan	G	T	13: 89,703,412	T1143K	possibly damaging	Het
Vmn2r61	T	A	7: 42,300,169	V671E	probably damaging	Het
Wdtc1	A	G	4: 133,322,218	V29A	probably damaging	Het
Zfp462	G	A	4: 55,080,735	M2450I	probably benign	Het
Zfp869	A	T	8: 69,707,199	C241*	probably null	Het

Other mutations in Tns3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Tns3	APN	11	8451066	missense	probably benign	0.42
IGL00822:Tns3	APN	11	8443976	missense	probably damaging	0.99
IGL01075:Tns3	APN	11	8478399	missense	probably benign	0.45
IGL01286:Tns3	APN	11	8492617	missense	probably benign	0.01
IGL01680:Tns3	APN	11	8548937	missense	probably damaging	1.00
IGL01687:Tns3	APN	11	8492798	missense	probably damaging	1.00
IGL01734:Tns3	APN	11	8519192	splice site	probably benign
IGL01844:Tns3	APN	11	8437177	missense	possibly damaging	0.58
IGL01984:Tns3	APN	11	8548992	nonsense	probably null
IGL02137:Tns3	APN	11	8492578	missense	possibly damaging	0.93
IGL02273:Tns3	APN	11	8434531	missense	probably damaging	1.00
IGL02623:Tns3	APN	11	8437141	missense	probably damaging	1.00
IGL02697:Tns3	APN	11	8492346	missense	probably benign	0.00
IGL02829:Tns3	APN	11	8519564	missense	probably damaging	1.00
ANU74:Tns3	UTSW	11	8492149	missense	probably benign	0.38
R0020:Tns3	UTSW	11	8545227	critical splice donor site	probably null
R0064:Tns3	UTSW	11	8435856	nonsense	probably null
R0064:Tns3	UTSW	11	8435856	nonsense	probably null
R0370:Tns3	UTSW	11	8445730	missense	possibly damaging	0.80
R0388:Tns3	UTSW	11	8445703	missense	probably benign	0.07
R0410:Tns3	UTSW	11	8435852	missense	probably benign	0.02
R0496:Tns3	UTSW	11	8547262	splice site	probably benign
R0562:Tns3	UTSW	11	8493262	missense	possibly damaging	0.93
R0626:Tns3	UTSW	11	8493121	missense	probably benign	0.04
R0736:Tns3	UTSW	11	8519474	missense	possibly damaging	0.94
R0893:Tns3	UTSW	11	8493302	missense	probably damaging	1.00
R1367:Tns3	UTSW	11	8448704	missense	probably benign	0.01
R1386:Tns3	UTSW	11	8518261	missense	probably benign	0.02
R1975:Tns3	UTSW	11	8435738	missense	probably benign	0.04
R2205:Tns3	UTSW	11	8531719	missense	probably damaging	1.00
R2319:Tns3	UTSW	11	8541200	missense	probably damaging	1.00
R2830:Tns3	UTSW	11	8435870	missense	probably damaging	1.00
R3720:Tns3	UTSW	11	8492999	missense	probably damaging	1.00
R3765:Tns3	UTSW	11	8451133	missense	probably benign	0.00
R3817:Tns3	UTSW	11	8434619	missense	probably damaging	1.00
R4058:Tns3	UTSW	11	8492275	missense	probably damaging	1.00
R4599:Tns3	UTSW	11	8531747	missense	probably damaging	1.00
R4631:Tns3	UTSW	11	8451119	missense	probably benign	0.30
R4731:Tns3	UTSW	11	8450986	missense	probably benign	0.28
R4732:Tns3	UTSW	11	8450986	missense	probably benign	0.28
R4733:Tns3	UTSW	11	8450986	missense	probably benign	0.28
R5472:Tns3	UTSW	11	8451092	missense	probably benign
R5749:Tns3	UTSW	11	8451177	missense	probably benign	0.01
R5807:Tns3	UTSW	11	8493211	missense	probably damaging	1.00
R5844:Tns3	UTSW	11	8434580	missense	probably damaging	1.00
R5942:Tns3	UTSW	11	8435860	missense	probably damaging	1.00
R5982:Tns3	UTSW	11	8492245	missense	probably damaging	0.99
R6025:Tns3	UTSW	11	8492578	missense	possibly damaging	0.93
R6266:Tns3	UTSW	11	8492987	missense	probably damaging	1.00
R6322:Tns3	UTSW	11	8492147	missense	probably benign	0.01
R6536:Tns3	UTSW	11	8434531	missense	probably damaging	1.00
R6577:Tns3	UTSW	11	8549057	missense	probably damaging	1.00
R6577:Tns3	UTSW	11	8549058	missense	probably damaging	1.00
R6864:Tns3	UTSW	11	8493196	missense	probably damaging	1.00
R6897:Tns3	UTSW	11	8531743	missense	probably damaging	1.00
R7108:Tns3	UTSW	11	8437251	missense	probably benign	0.00
R7443:Tns3	UTSW	11	8451442	missense	probably benign	0.01
R7459:Tns3	UTSW	11	8492793	missense	probably benign	0.16
R7474:Tns3	UTSW	11	8530894	missense	probably damaging	1.00
R7576:Tns3	UTSW	11	8541192	missense	possibly damaging	0.78
R7979:Tns3	UTSW	11	8492701	missense	probably benign	0.01
R8055:Tns3	UTSW	11	8545343	missense	probably damaging	1.00
R8057:Tns3	UTSW	11	8492773	missense	probably benign
R8077:Tns3	UTSW	11	8445667	missense	probably damaging	1.00
R8518:Tns3	UTSW	11	8492971	missense	probably damaging	0.96
R8523:Tns3	UTSW	11	8448779	missense	probably damaging	1.00
R8790:Tns3	UTSW	11	8518273	missense	probably damaging	0.99
R9228:Tns3	UTSW	11	8450094	missense	probably damaging	1.00
R9374:Tns3	UTSW	11	8492606	missense	probably damaging	1.00
R9510:Tns3	UTSW	11	8445702	missense	probably damaging	0.99
R9594:Tns3	UTSW	11	8451142	missense	possibly damaging	0.79
R9595:Tns3	UTSW	11	8451142	missense	possibly damaging	0.79
R9596:Tns3	UTSW	11	8451142	missense	possibly damaging	0.79
R9624:Tns3	UTSW	11	8451142	missense	possibly damaging	0.79
R9629:Tns3	UTSW	11	8451142	missense	possibly damaging	0.79
T0975:Tns3	UTSW	11	8451146	missense	probably benign	0.00
T0975:Tns3	UTSW	11	8479518	missense	probably benign
T0975:Tns3	UTSW	11	8549100	start gained	probably benign
X0005:Tns3	UTSW	11	8451224	missense	probably benign	0.00
X0005:Tns3	UTSW	11	8479518	missense	probably benign
Z1177:Tns3	UTSW	11	8451014	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CTTATCTTAAAGACCTCACGTGGC -3'
(R):5'- AGATTTGATATCTGCAGGAGGC -3'

Sequencing Primer
(F):5'- TCACGTGGCAGCCTGAC -3'
(R):5'- GAGGCAGATATAAAAGCTTGTCTGTC -3'

Posted On

2022-06-15