Incidental Mutation 'R9476:Itpr3'
ID 715818
Institutional Source Beutler Lab
Gene Symbol Itpr3
Ensembl Gene ENSMUSG00000042644
Gene Name inositol 1,4,5-triphosphate receptor 3
Synonyms Itpr-3, Ip3r3, tf
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9476 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 27276278-27341197 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) G to A at 27337651 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025045] [ENSMUST00000049308] [ENSMUST00000118613] [ENSMUST00000119227]
AlphaFold P70227
Predicted Effect probably benign
Transcript: ENSMUST00000025045
Predicted Effect probably null
Transcript: ENSMUST00000049308
SMART Domains Protein: ENSMUSP00000038150
Gene: ENSMUSG00000042644

DomainStartEndE-ValueType
MIR 113 167 7.75e-6 SMART
MIR 174 224 1.16e-4 SMART
MIR 232 288 1.21e-7 SMART
MIR 295 402 9.38e-14 SMART
Pfam:RYDR_ITPR 473 670 7.8e-64 PFAM
low complexity region 881 889 N/A INTRINSIC
Pfam:RYDR_ITPR 1175 1333 5.8e-16 PFAM
low complexity region 1549 1567 N/A INTRINSIC
low complexity region 1831 1851 N/A INTRINSIC
Pfam:RIH_assoc 1863 1973 2.6e-34 PFAM
transmembrane domain 2203 2225 N/A INTRINSIC
Pfam:Ion_trans 2235 2527 8.1e-20 PFAM
coiled coil region 2631 2660 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118613
Predicted Effect probably benign
Transcript: ENSMUST00000119227
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for inositol 1,4,5-trisphosphate, a second messenger that mediates the release of intracellular calcium. The receptor contains a calcium channel at the C-terminus and the ligand-binding site at the N-terminus. Knockout studies in mice suggest that type 2 and type 3 inositol 1,4,5-trisphosphate receptors play a key role in exocrine secretion underlying energy metabolism and growth. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and exhibit no apparent abnormalities in pancreatic and salivary secretion. However, one mutation in this gene results in alternating abnormal hair loss and normal hair growth throughout the life of the mouse and low sweet preference. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578G10Rik T G 4: 42,760,998 (GRCm39) W6G unknown Het
Aatk A T 11: 119,901,094 (GRCm39) C1101S probably benign Het
Abcb4 A T 5: 8,977,790 (GRCm39) D456V probably damaging Het
Abcc8 T C 7: 45,819,270 (GRCm39) E186G possibly damaging Het
Adam18 T C 8: 25,115,807 (GRCm39) N629S probably benign Het
Angpt2 T G 8: 18,764,143 (GRCm39) N133T probably benign Het
Ankrd13c T A 3: 157,697,396 (GRCm39) S334T probably benign Het
Ankrd13d A T 19: 4,320,289 (GRCm39) S151T unknown Het
Ap3d1 G A 10: 80,545,655 (GRCm39) P1025S probably benign Het
Bhlhe41 G A 6: 145,808,948 (GRCm39) A288V possibly damaging Het
Cacna1b T C 2: 24,540,058 (GRCm39) E1467G probably damaging Het
Cacna1h T A 17: 25,611,524 (GRCm39) T425S probably damaging Het
Cdk13 A C 13: 17,902,747 (GRCm39) C934W probably damaging Het
Ces1b T A 8: 93,799,890 (GRCm39) N162I probably damaging Het
Clec9a T A 6: 129,398,023 (GRCm39) I187K possibly damaging Het
Cpsf3 A G 12: 21,350,080 (GRCm39) I266M probably damaging Het
Cr2 G T 1: 194,840,416 (GRCm39) L509M probably damaging Het
Creb3l2 C A 6: 37,311,446 (GRCm39) G448W probably damaging Het
Csmd1 T A 8: 15,981,215 (GRCm39) probably null Het
Cul9 G A 17: 46,821,833 (GRCm39) R1881W probably damaging Het
Cyth1 C T 11: 118,076,206 (GRCm39) probably null Het
Dnhd1 A T 7: 105,352,889 (GRCm39) N2681Y possibly damaging Het
Dnm1 T C 2: 32,213,739 (GRCm39) M476V probably benign Het
Dnmt3a A G 12: 3,957,707 (GRCm39) H896R probably damaging Het
Dock1 T G 7: 134,592,279 (GRCm39) I938S probably benign Het
Dock6 G A 9: 21,724,821 (GRCm39) L1515F probably damaging Het
Dusp16 T C 6: 134,695,226 (GRCm39) H535R probably benign Het
Fancd2os T A 6: 113,574,994 (GRCm39) Y4F probably damaging Het
Fat4 A T 3: 39,037,886 (GRCm39) Q3846L probably benign Het
Fbxw10 A C 11: 62,743,814 (GRCm39) H240P probably benign Het
Frmd4a A G 2: 4,608,324 (GRCm39) T731A probably benign Het
Gm44501 T A 17: 40,889,820 (GRCm39) H111Q possibly damaging Het
Gsdmc T C 15: 63,650,551 (GRCm39) M277V probably benign Het
Hira A G 16: 18,772,789 (GRCm39) D867G probably damaging Het
Hmcn1 A G 1: 150,462,127 (GRCm39) S5184P probably benign Het
Ighv1-26 A C 12: 114,752,407 (GRCm39) F7V probably benign Het
Igkv4-81 C T 6: 68,967,796 (GRCm39) E102K possibly damaging Het
Inmt G T 6: 55,147,990 (GRCm39) S213Y possibly damaging Het
Ints2 T A 11: 86,135,335 (GRCm39) M360L probably benign Het
Itih3 A G 14: 30,631,416 (GRCm39) S827P probably benign Het
Kcnk12 C A 17: 88,054,122 (GRCm39) R180L probably benign Het
Kndc1 G A 7: 139,510,031 (GRCm39) S1291N probably benign Het
Mettl21a T C 1: 64,647,285 (GRCm39) T91A probably damaging Het
Mmrn2 A G 14: 34,120,407 (GRCm39) I426V possibly damaging Het
Mrpl21 T G 19: 3,337,704 (GRCm39) V137G probably damaging Het
Nrbp2 T C 15: 75,961,626 (GRCm39) N218S probably damaging Het
Nrip1 T C 16: 76,089,820 (GRCm39) N579S probably benign Het
Nsf T C 11: 103,763,988 (GRCm39) N365S probably damaging Het
Or6c5 A G 10: 129,074,656 (GRCm39) I213V probably damaging Het
Or7g28 A T 9: 19,272,383 (GRCm39) D89E probably benign Het
Osbpl3 C T 6: 50,313,194 (GRCm39) probably null Het
Oscar T A 7: 3,614,843 (GRCm39) H43L probably benign Het
Pam C T 1: 97,826,065 (GRCm39) probably null Het
Parn A T 16: 13,358,942 (GRCm39) M600K probably benign Het
Pcdha11 C A 18: 37,139,532 (GRCm39) T387N probably benign Het
Plce1 G A 19: 38,766,337 (GRCm39) E2121K possibly damaging Het
Prune2 T A 19: 17,096,706 (GRCm39) Y737N possibly damaging Het
Ptch1 G A 13: 63,681,448 (GRCm39) P613L probably benign Het
Ptprt A C 2: 161,397,381 (GRCm39) C1129G probably damaging Het
Rara C T 11: 98,860,983 (GRCm39) S157L probably benign Het
Rest T A 5: 77,416,098 (GRCm39) M104K probably damaging Het
Rfc1 A G 5: 65,437,142 (GRCm39) S513P probably damaging Het
Rnf40 T A 7: 127,201,808 (GRCm39) I1000N probably damaging Het
Scube2 C T 7: 109,430,969 (GRCm39) G410E probably damaging Het
Sh3gl2 A G 4: 85,304,089 (GRCm39) E264G probably benign Het
Shank1 G A 7: 43,962,342 (GRCm39) S71N unknown Het
Smc4 T G 3: 68,914,662 (GRCm39) S92A probably damaging Het
Spata31d1b A G 13: 59,863,467 (GRCm39) D205G probably benign Het
Spata31e4 A G 13: 50,856,149 (GRCm39) T596A possibly damaging Het
Spef2 T C 15: 9,713,203 (GRCm39) R390G probably damaging Het
Speg T C 1: 75,377,768 (GRCm39) F842S probably damaging Het
Stk17b G T 1: 53,796,898 (GRCm39) H290N probably damaging Het
Stpg3 A T 2: 25,103,516 (GRCm39) V191D probably benign Het
Supt6 C T 11: 78,120,290 (GRCm39) R350H probably damaging Het
Tet3 T C 6: 83,380,935 (GRCm39) E411G possibly damaging Het
Tet3 T A 6: 83,381,808 (GRCm39) probably null Het
Tns3 A G 11: 8,395,702 (GRCm39) I1234T probably damaging Het
Trim34b A G 7: 103,980,503 (GRCm39) E197G probably damaging Het
Vcan G T 13: 89,851,531 (GRCm39) T1143K possibly damaging Het
Vmn2r61 T A 7: 41,949,593 (GRCm39) V671E probably damaging Het
Wdtc1 A G 4: 133,049,529 (GRCm39) V29A probably damaging Het
Zfp462 G A 4: 55,080,735 (GRCm39) M2450I probably benign Het
Zfp869 A T 8: 70,159,849 (GRCm39) C241* probably null Het
Other mutations in Itpr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Itpr3 APN 17 27,302,603 (GRCm39) missense probably benign 0.05
IGL00980:Itpr3 APN 17 27,329,930 (GRCm39) missense probably benign
IGL01151:Itpr3 APN 17 27,310,503 (GRCm39) missense probably damaging 1.00
IGL01289:Itpr3 APN 17 27,318,739 (GRCm39) missense probably damaging 0.99
IGL01403:Itpr3 APN 17 27,337,569 (GRCm39) missense probably damaging 0.97
IGL01666:Itpr3 APN 17 27,336,152 (GRCm39) missense probably benign 0.02
IGL01897:Itpr3 APN 17 27,330,236 (GRCm39) missense probably damaging 1.00
IGL02003:Itpr3 APN 17 27,340,449 (GRCm39) missense probably damaging 1.00
IGL02012:Itpr3 APN 17 27,323,069 (GRCm39) missense probably benign
IGL02063:Itpr3 APN 17 27,338,997 (GRCm39) missense probably benign 0.01
IGL02146:Itpr3 APN 17 27,336,249 (GRCm39) missense probably damaging 1.00
IGL02158:Itpr3 APN 17 27,317,416 (GRCm39) missense probably damaging 1.00
IGL02177:Itpr3 APN 17 27,318,588 (GRCm39) missense possibly damaging 0.74
IGL02247:Itpr3 APN 17 27,317,153 (GRCm39) missense probably damaging 1.00
IGL02606:Itpr3 APN 17 27,333,486 (GRCm39) splice site probably benign
IGL02651:Itpr3 APN 17 27,325,372 (GRCm39) missense probably damaging 0.99
IGL02902:Itpr3 APN 17 27,323,530 (GRCm39) missense probably benign 0.21
IGL03001:Itpr3 APN 17 27,308,586 (GRCm39) splice site probably benign
IGL03004:Itpr3 APN 17 27,316,952 (GRCm39) missense possibly damaging 0.90
IGL03065:Itpr3 APN 17 27,310,907 (GRCm39) missense probably damaging 1.00
IGL03117:Itpr3 APN 17 27,338,240 (GRCm39) missense probably damaging 1.00
IGL03181:Itpr3 APN 17 27,330,242 (GRCm39) missense probably benign
IGL03404:Itpr3 APN 17 27,310,492 (GRCm39) missense probably damaging 1.00
Allure UTSW 17 27,326,277 (GRCm39) missense probably damaging 1.00
alopecia UTSW 17 27,314,452 (GRCm39) missense probably damaging 0.98
Beauty UTSW 17 27,325,316 (GRCm39) missense probably damaging 1.00
Opuesto UTSW 17 27,306,566 (GRCm39) missense probably damaging 1.00
Paradox UTSW 17 27,317,145 (GRCm39) missense probably damaging 1.00
Pulchritude UTSW 17 27,305,934 (GRCm39) missense probably damaging 0.97
R0010:Itpr3 UTSW 17 27,339,951 (GRCm39) missense probably damaging 1.00
R0055:Itpr3 UTSW 17 27,317,296 (GRCm39) missense probably damaging 1.00
R0068:Itpr3 UTSW 17 27,323,034 (GRCm39) splice site probably benign
R0068:Itpr3 UTSW 17 27,323,034 (GRCm39) splice site probably benign
R0104:Itpr3 UTSW 17 27,314,966 (GRCm39) missense probably benign 0.01
R0195:Itpr3 UTSW 17 27,333,088 (GRCm39) missense probably damaging 1.00
R0212:Itpr3 UTSW 17 27,308,293 (GRCm39) missense probably damaging 1.00
R0454:Itpr3 UTSW 17 27,332,793 (GRCm39) missense probably benign
R0485:Itpr3 UTSW 17 27,330,903 (GRCm39) missense probably damaging 0.98
R0501:Itpr3 UTSW 17 27,326,263 (GRCm39) missense probably benign 0.09
R0781:Itpr3 UTSW 17 27,329,529 (GRCm39) missense probably benign 0.00
R0890:Itpr3 UTSW 17 27,307,985 (GRCm39) nonsense probably null
R1028:Itpr3 UTSW 17 27,310,343 (GRCm39) missense probably benign 0.04
R1144:Itpr3 UTSW 17 27,333,897 (GRCm39) missense probably benign 0.01
R1347:Itpr3 UTSW 17 27,330,535 (GRCm39) missense probably benign 0.02
R1347:Itpr3 UTSW 17 27,330,535 (GRCm39) missense probably benign 0.02
R1458:Itpr3 UTSW 17 27,337,346 (GRCm39) missense probably benign 0.01
R1463:Itpr3 UTSW 17 27,336,128 (GRCm39) splice site probably benign
R1472:Itpr3 UTSW 17 27,333,199 (GRCm39) missense probably benign 0.09
R1529:Itpr3 UTSW 17 27,324,459 (GRCm39) splice site probably null
R1533:Itpr3 UTSW 17 27,314,534 (GRCm39) missense possibly damaging 0.71
R1537:Itpr3 UTSW 17 27,333,121 (GRCm39) missense possibly damaging 0.96
R1618:Itpr3 UTSW 17 27,335,581 (GRCm39) critical splice acceptor site probably null
R1672:Itpr3 UTSW 17 27,307,987 (GRCm39) missense probably benign
R1726:Itpr3 UTSW 17 27,330,664 (GRCm39) missense probably damaging 0.96
R1865:Itpr3 UTSW 17 27,338,997 (GRCm39) missense probably benign 0.01
R1940:Itpr3 UTSW 17 27,330,191 (GRCm39) missense probably damaging 1.00
R2023:Itpr3 UTSW 17 27,321,785 (GRCm39) missense possibly damaging 0.76
R2063:Itpr3 UTSW 17 27,317,050 (GRCm39) missense probably benign 0.19
R2064:Itpr3 UTSW 17 27,317,050 (GRCm39) missense probably benign 0.19
R2065:Itpr3 UTSW 17 27,317,050 (GRCm39) missense probably benign 0.19
R2067:Itpr3 UTSW 17 27,317,050 (GRCm39) missense probably benign 0.19
R2068:Itpr3 UTSW 17 27,317,050 (GRCm39) missense probably benign 0.19
R2219:Itpr3 UTSW 17 27,334,027 (GRCm39) missense probably benign
R2248:Itpr3 UTSW 17 27,334,033 (GRCm39) missense probably damaging 1.00
R2291:Itpr3 UTSW 17 27,332,553 (GRCm39) missense possibly damaging 0.92
R2320:Itpr3 UTSW 17 27,314,889 (GRCm39) missense probably benign
R2864:Itpr3 UTSW 17 27,310,525 (GRCm39) missense probably benign 0.01
R2865:Itpr3 UTSW 17 27,310,525 (GRCm39) missense probably benign 0.01
R3778:Itpr3 UTSW 17 27,314,446 (GRCm39) missense possibly damaging 0.57
R3881:Itpr3 UTSW 17 27,332,814 (GRCm39) missense probably benign 0.01
R3979:Itpr3 UTSW 17 27,310,546 (GRCm39) missense probably damaging 1.00
R3979:Itpr3 UTSW 17 27,304,105 (GRCm39) missense probably benign 0.23
R4224:Itpr3 UTSW 17 27,326,232 (GRCm39) missense probably damaging 1.00
R4259:Itpr3 UTSW 17 27,325,298 (GRCm39) missense probably damaging 1.00
R4321:Itpr3 UTSW 17 27,330,948 (GRCm39) missense probably benign 0.00
R4466:Itpr3 UTSW 17 27,325,316 (GRCm39) missense probably damaging 1.00
R4493:Itpr3 UTSW 17 27,323,586 (GRCm39) missense probably damaging 1.00
R4597:Itpr3 UTSW 17 27,312,257 (GRCm39) missense probably damaging 1.00
R4823:Itpr3 UTSW 17 27,304,121 (GRCm39) missense probably benign 0.30
R4921:Itpr3 UTSW 17 27,316,979 (GRCm39) missense probably damaging 1.00
R4974:Itpr3 UTSW 17 27,302,582 (GRCm39) missense probably damaging 0.96
R5063:Itpr3 UTSW 17 27,308,885 (GRCm39) missense possibly damaging 0.94
R5079:Itpr3 UTSW 17 27,317,397 (GRCm39) missense probably damaging 1.00
R5303:Itpr3 UTSW 17 27,335,663 (GRCm39) missense probably benign 0.38
R5518:Itpr3 UTSW 17 27,306,566 (GRCm39) missense probably damaging 1.00
R5521:Itpr3 UTSW 17 27,326,308 (GRCm39) missense probably benign 0.09
R5566:Itpr3 UTSW 17 27,334,926 (GRCm39) missense possibly damaging 0.71
R5567:Itpr3 UTSW 17 27,322,880 (GRCm39) missense possibly damaging 0.66
R5579:Itpr3 UTSW 17 27,332,493 (GRCm39) missense probably damaging 1.00
R5610:Itpr3 UTSW 17 27,337,540 (GRCm39) missense probably benign 0.42
R5658:Itpr3 UTSW 17 27,326,852 (GRCm39) missense possibly damaging 0.74
R5856:Itpr3 UTSW 17 27,325,379 (GRCm39) missense probably damaging 1.00
R5872:Itpr3 UTSW 17 27,305,950 (GRCm39) missense probably benign 0.02
R5878:Itpr3 UTSW 17 27,329,836 (GRCm39) missense probably benign 0.01
R5889:Itpr3 UTSW 17 27,334,039 (GRCm39) missense probably damaging 0.99
R5907:Itpr3 UTSW 17 27,336,867 (GRCm39) missense probably damaging 1.00
R5930:Itpr3 UTSW 17 27,329,895 (GRCm39) missense possibly damaging 0.49
R5987:Itpr3 UTSW 17 27,323,575 (GRCm39) missense probably damaging 1.00
R6029:Itpr3 UTSW 17 27,317,145 (GRCm39) missense probably damaging 1.00
R6195:Itpr3 UTSW 17 27,305,934 (GRCm39) missense probably damaging 0.97
R6213:Itpr3 UTSW 17 27,330,174 (GRCm39) missense probably benign 0.03
R6233:Itpr3 UTSW 17 27,305,934 (GRCm39) missense probably damaging 0.97
R6376:Itpr3 UTSW 17 27,314,449 (GRCm39) missense possibly damaging 0.94
R6514:Itpr3 UTSW 17 27,310,344 (GRCm39) missense probably benign
R6515:Itpr3 UTSW 17 27,310,344 (GRCm39) missense probably benign
R6516:Itpr3 UTSW 17 27,310,344 (GRCm39) missense probably benign
R6955:Itpr3 UTSW 17 27,340,441 (GRCm39) missense probably damaging 1.00
R7002:Itpr3 UTSW 17 27,329,554 (GRCm39) missense probably benign 0.00
R7064:Itpr3 UTSW 17 27,308,269 (GRCm39) missense probably damaging 1.00
R7257:Itpr3 UTSW 17 27,337,535 (GRCm39) missense probably benign 0.00
R7349:Itpr3 UTSW 17 27,326,786 (GRCm39) splice site probably null
R7469:Itpr3 UTSW 17 27,340,028 (GRCm39) missense possibly damaging 0.74
R7493:Itpr3 UTSW 17 27,313,774 (GRCm39) missense probably benign 0.09
R7510:Itpr3 UTSW 17 27,308,013 (GRCm39) missense probably damaging 0.97
R7565:Itpr3 UTSW 17 27,329,862 (GRCm39) missense probably benign 0.01
R7616:Itpr3 UTSW 17 27,307,951 (GRCm39) missense probably damaging 1.00
R7728:Itpr3 UTSW 17 27,317,088 (GRCm39) missense probably damaging 1.00
R7779:Itpr3 UTSW 17 27,315,037 (GRCm39) missense probably damaging 1.00
R7788:Itpr3 UTSW 17 27,337,571 (GRCm39) nonsense probably null
R7871:Itpr3 UTSW 17 27,336,153 (GRCm39) missense probably damaging 1.00
R7889:Itpr3 UTSW 17 27,335,751 (GRCm39) missense probably damaging 1.00
R7966:Itpr3 UTSW 17 27,331,002 (GRCm39) critical splice donor site probably null
R8065:Itpr3 UTSW 17 27,329,836 (GRCm39) missense probably benign 0.01
R8067:Itpr3 UTSW 17 27,329,836 (GRCm39) missense probably benign 0.01
R8230:Itpr3 UTSW 17 27,326,711 (GRCm39) critical splice donor site probably null
R8263:Itpr3 UTSW 17 27,334,887 (GRCm39) nonsense probably null
R8264:Itpr3 UTSW 17 27,323,086 (GRCm39) synonymous silent
R8269:Itpr3 UTSW 17 27,312,258 (GRCm39) missense possibly damaging 0.60
R8271:Itpr3 UTSW 17 27,306,622 (GRCm39) missense probably damaging 1.00
R8316:Itpr3 UTSW 17 27,325,199 (GRCm39) missense possibly damaging 0.50
R8354:Itpr3 UTSW 17 27,334,893 (GRCm39) missense possibly damaging 0.74
R8413:Itpr3 UTSW 17 27,330,900 (GRCm39) missense probably damaging 1.00
R8437:Itpr3 UTSW 17 27,326,277 (GRCm39) missense probably damaging 1.00
R8676:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R8679:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R8846:Itpr3 UTSW 17 27,330,996 (GRCm39) missense probably damaging 1.00
R8884:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R8885:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R8886:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R8887:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R8888:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R8891:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R8896:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R8975:Itpr3 UTSW 17 27,335,628 (GRCm39) missense possibly damaging 0.56
R9025:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9026:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9063:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9087:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9088:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9089:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9090:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9091:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9200:Itpr3 UTSW 17 27,326,636 (GRCm39) missense probably damaging 0.99
R9270:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9271:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9294:Itpr3 UTSW 17 27,330,191 (GRCm39) missense probably damaging 1.00
R9389:Itpr3 UTSW 17 27,314,899 (GRCm39) missense possibly damaging 0.84
R9433:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9434:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9443:Itpr3 UTSW 17 27,324,523 (GRCm39) missense probably damaging 1.00
R9472:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9474:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9475:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9477:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9507:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9508:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9511:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9694:Itpr3 UTSW 17 27,334,927 (GRCm39) missense probably damaging 0.99
R9789:Itpr3 UTSW 17 27,308,915 (GRCm39) missense probably benign 0.15
V7732:Itpr3 UTSW 17 27,330,000 (GRCm39) splice site probably null
V7732:Itpr3 UTSW 17 27,329,998 (GRCm39) splice site probably benign
Z1088:Itpr3 UTSW 17 27,332,502 (GRCm39) missense possibly damaging 0.50
Z1177:Itpr3 UTSW 17 27,338,961 (GRCm39) missense probably damaging 1.00
Z1177:Itpr3 UTSW 17 27,333,903 (GRCm39) missense probably damaging 1.00
Z31818:Itpr3 UTSW 17 27,314,452 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTGAGATCCTAGAAGGTGAGACCG -3'
(R):5'- AAGCCACTGACTGCTGATG -3'

Sequencing Primer
(F):5'- ACCGGCGTCTACAGGATAG -3'
(R):5'- ACTGACTGCTGATGGCCCAC -3'
Posted On 2022-06-15