Incidental Mutation 'R9477:Sema3c'
ID 715849
Institutional Source Beutler Lab
Gene Symbol Sema3c
Ensembl Gene ENSMUSG00000028780
Gene Name sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C
Synonyms Semae, 1110036B02Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9477 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 17779814-17935266 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 17921981 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 520 (A520T)
Ref Sequence ENSEMBL: ENSMUSP00000030568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030568]
AlphaFold Q62181
Predicted Effect
SMART Domains Protein: ENSMUSP00000030568
Gene: ENSMUSG00000028780
AA Change: A520T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Sema 54 495 1.16e-200 SMART
PSI 513 565 2.87e-13 SMART
IG 577 662 7.08e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU mutation exhibit perinatal lethality, hypopigmentation and abnormal heart development. Mice homozygous for a knock-out allele exhibit prenatal lethality associated with heart defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A T 1: 89,765,485 (GRCm39) M618L probably benign Het
Anxa2r2 A T 13: 120,488,282 (GRCm39) I89N probably damaging Het
App C A 16: 84,853,392 (GRCm39) A229S unknown Het
B020011L13Rik G T 1: 117,728,903 (GRCm39) E137* probably null Het
BC034090 C T 1: 155,102,087 (GRCm39) G59E probably damaging Het
C1ra A G 6: 124,499,455 (GRCm39) D547G probably benign Het
Cdh2 A T 18: 16,755,212 (GRCm39) D774E probably damaging Het
Cdon A G 9: 35,403,201 (GRCm39) N1104D probably damaging Het
Cecr2 G A 6: 120,720,743 (GRCm39) probably null Het
Ces2b A T 8: 105,560,556 (GRCm39) N124Y probably damaging Het
Cfap61 A G 2: 145,985,032 (GRCm39) T959A probably benign Het
Chaf1a A T 17: 56,369,244 (GRCm39) K492* probably null Het
Clec14a A G 12: 58,314,620 (GRCm39) V334A probably benign Het
Col6a3 A G 1: 90,706,621 (GRCm39) I2771T unknown Het
Creb3 T C 4: 43,566,298 (GRCm39) L244P probably damaging Het
Crispld1 T C 1: 17,816,956 (GRCm39) V171A probably benign Het
Crmp1 T C 5: 37,446,182 (GRCm39) Y613H probably damaging Het
Csrnp3 G A 2: 65,852,819 (GRCm39) V416I probably benign Het
Dhrs1 A G 14: 55,976,868 (GRCm39) V272A probably benign Het
Dip2b T C 15: 99,936,784 (GRCm39) S32P probably damaging Het
Dpp10 G T 1: 123,304,370 (GRCm39) T510K possibly damaging Het
Dst A G 1: 34,205,292 (GRCm39) Y820C probably damaging Het
Efcab3 A T 11: 104,836,698 (GRCm39) H3562L unknown Het
Fam3c A T 6: 22,308,479 (GRCm39) M238K probably damaging Het
Fcgbpl1 T C 7: 27,852,265 (GRCm39) F1263L probably damaging Het
Fcrl2 A T 3: 87,159,803 (GRCm39) C484S probably damaging Het
Fsd1 T C 17: 56,295,720 (GRCm39) L97P possibly damaging Het
Gapdhs T C 7: 30,431,682 (GRCm39) I310V probably damaging Het
Gimap4 A T 6: 48,667,314 (GRCm39) N23I probably benign Het
Gpr21 T A 2: 37,408,386 (GRCm39) F311I probably damaging Het
Grm1 T C 10: 10,595,405 (GRCm39) E741G probably benign Het
Gsto2 G A 19: 47,864,911 (GRCm39) R148H probably benign Het
Gzmd A G 14: 56,368,813 (GRCm39) V27A probably benign Het
Hbp1 A G 12: 31,980,766 (GRCm39) C446R probably damaging Het
Hmcn2 A T 2: 31,286,031 (GRCm39) probably null Het
Ifi205 G A 1: 173,854,155 (GRCm39) T166I probably benign Het
Il23a T A 10: 128,133,922 (GRCm39) probably benign Het
Itpr3 G A 17: 27,337,651 (GRCm39) probably benign Het
Jag1 A T 2: 136,936,409 (GRCm39) C362S probably damaging Het
Jmjd1c A T 10: 66,993,734 (GRCm39) R72* probably null Het
Kcna6 A G 6: 126,716,361 (GRCm39) I176T probably damaging Het
Marchf1 T C 8: 66,871,542 (GRCm39) V102A probably damaging Het
Mast1 T C 8: 85,638,779 (GRCm39) K1517E probably benign Het
Mbnl1 A G 3: 60,520,769 (GRCm39) D119G probably damaging Het
Mfsd8 A G 3: 40,785,057 (GRCm39) probably null Het
Mtus2 T G 5: 148,014,740 (GRCm39) V511G probably benign Het
Myot A C 18: 44,470,333 (GRCm39) Q103H probably benign Het
Nrip2 G A 6: 128,377,145 (GRCm39) D24N probably benign Het
Ntm T A 9: 29,322,922 (GRCm39) S33C probably benign Het
Nus1 C T 10: 52,294,001 (GRCm39) T55M possibly damaging Het
Or4c112 G A 2: 88,853,615 (GRCm39) T244I probably benign Het
Pik3cb C T 9: 98,922,973 (GRCm39) probably null Het
Pogk T C 1: 166,227,404 (GRCm39) N249S probably damaging Het
Pou1f1 C T 16: 65,320,503 (GRCm39) T66I possibly damaging Het
Ppp1r42 T G 1: 10,055,854 (GRCm39) K211N probably damaging Het
Ppp2r3d C A 9: 124,476,857 (GRCm38) D2Y Het
Prdm5 A T 6: 65,771,342 (GRCm39) N51I possibly damaging Het
Rif1 G A 2: 52,001,342 (GRCm39) A1599T probably benign Het
Shank1 G A 7: 43,962,342 (GRCm39) S71N unknown Het
Spice1 T A 16: 44,197,183 (GRCm39) N489K possibly damaging Het
Sptbn4 A G 7: 27,132,624 (GRCm39) M116T possibly damaging Het
Supt5 T A 7: 28,025,500 (GRCm39) N249Y probably damaging Het
Tex2 A G 11: 106,410,706 (GRCm39) probably null Het
Trhde T A 10: 114,338,980 (GRCm39) E610V probably benign Het
Trmt12 T C 15: 58,745,471 (GRCm39) S290P possibly damaging Het
Trpm2 C T 10: 77,747,224 (GRCm39) V1425M probably benign Het
Uaca T C 9: 60,778,108 (GRCm39) S832P probably benign Het
Vcan T A 13: 89,841,128 (GRCm39) D1472V probably damaging Het
Virma A G 4: 11,528,753 (GRCm39) E1330G probably damaging Het
Vmn1r125 T G 7: 21,006,261 (GRCm39) V53G possibly damaging Het
Vmn2r27 A T 6: 124,168,910 (GRCm39) I740N probably damaging Het
Vmn2r70 C T 7: 85,218,244 (GRCm39) C18Y possibly damaging Het
Zfp35 A G 18: 24,136,188 (GRCm39) I177M possibly damaging Het
Zfp532 T C 18: 65,777,428 (GRCm39) I895T probably benign Het
Zfp58 C A 13: 67,640,158 (GRCm39) C111F probably damaging Het
Other mutations in Sema3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Sema3c APN 5 17,899,858 (GRCm39) missense probably damaging 1.00
IGL01528:Sema3c APN 5 17,919,413 (GRCm39) missense probably benign
IGL01618:Sema3c APN 5 17,877,504 (GRCm39) missense probably damaging 1.00
IGL01730:Sema3c APN 5 17,916,434 (GRCm39) missense probably benign 0.01
IGL01762:Sema3c APN 5 17,899,849 (GRCm39) missense possibly damaging 0.81
IGL02049:Sema3c APN 5 17,926,923 (GRCm39) splice site probably benign
IGL02249:Sema3c APN 5 17,867,961 (GRCm39) missense probably damaging 1.00
IGL02657:Sema3c APN 5 17,867,972 (GRCm39) missense probably damaging 1.00
IGL02657:Sema3c APN 5 17,781,866 (GRCm39) start codon destroyed possibly damaging 0.71
IGL03213:Sema3c APN 5 17,899,637 (GRCm39) splice site probably benign
PIT4651001:Sema3c UTSW 5 17,899,731 (GRCm39) missense probably benign 0.37
R0031:Sema3c UTSW 5 17,899,726 (GRCm39) missense probably damaging 1.00
R0558:Sema3c UTSW 5 17,919,413 (GRCm39) missense probably benign 0.00
R0964:Sema3c UTSW 5 17,926,907 (GRCm39) missense probably damaging 1.00
R1164:Sema3c UTSW 5 17,883,312 (GRCm39) missense probably benign 0.40
R1351:Sema3c UTSW 5 17,883,334 (GRCm39) missense possibly damaging 0.60
R1368:Sema3c UTSW 5 17,883,330 (GRCm39) missense possibly damaging 0.96
R1480:Sema3c UTSW 5 17,887,029 (GRCm39) missense possibly damaging 0.57
R1880:Sema3c UTSW 5 17,932,464 (GRCm39) nonsense probably null
R1916:Sema3c UTSW 5 17,932,399 (GRCm39) missense probably benign 0.06
R3934:Sema3c UTSW 5 17,886,938 (GRCm39) missense probably damaging 0.97
R4284:Sema3c UTSW 5 17,883,345 (GRCm39) missense probably benign 0.01
R4449:Sema3c UTSW 5 17,781,844 (GRCm39) start gained probably benign
R4545:Sema3c UTSW 5 17,899,770 (GRCm39) missense probably benign 0.01
R4546:Sema3c UTSW 5 17,899,770 (GRCm39) missense probably benign 0.01
R4660:Sema3c UTSW 5 17,877,511 (GRCm39) missense probably damaging 1.00
R4890:Sema3c UTSW 5 17,880,157 (GRCm39) missense probably benign 0.00
R4937:Sema3c UTSW 5 17,899,684 (GRCm39) missense probably benign 0.01
R5065:Sema3c UTSW 5 17,932,615 (GRCm39) missense possibly damaging 0.89
R5145:Sema3c UTSW 5 17,932,615 (GRCm39) missense possibly damaging 0.89
R5452:Sema3c UTSW 5 17,922,068 (GRCm39) critical splice donor site probably null
R5586:Sema3c UTSW 5 17,916,422 (GRCm39) missense probably damaging 0.99
R5811:Sema3c UTSW 5 17,880,188 (GRCm39) splice site probably null
R5886:Sema3c UTSW 5 17,886,984 (GRCm39) missense possibly damaging 0.90
R6120:Sema3c UTSW 5 17,932,630 (GRCm39) missense probably benign 0.00
R6191:Sema3c UTSW 5 17,858,804 (GRCm39) missense probably damaging 1.00
R6318:Sema3c UTSW 5 17,877,430 (GRCm39) missense probably damaging 0.96
R6416:Sema3c UTSW 5 17,781,959 (GRCm39) missense probably damaging 0.99
R6441:Sema3c UTSW 5 17,929,130 (GRCm39) missense possibly damaging 0.96
R6816:Sema3c UTSW 5 17,875,463 (GRCm39) missense probably benign 0.36
R7146:Sema3c UTSW 5 17,899,701 (GRCm39) missense probably benign 0.22
R7526:Sema3c UTSW 5 17,932,594 (GRCm39) missense possibly damaging 0.46
R7832:Sema3c UTSW 5 17,899,845 (GRCm39) missense probably damaging 0.99
R8034:Sema3c UTSW 5 17,932,480 (GRCm39) missense probably damaging 1.00
R8053:Sema3c UTSW 5 17,860,020 (GRCm39) missense probably benign 0.00
R8076:Sema3c UTSW 5 17,932,362 (GRCm39) missense probably benign 0.00
R8264:Sema3c UTSW 5 17,881,537 (GRCm39) intron probably benign
R8359:Sema3c UTSW 5 17,858,726 (GRCm39) missense possibly damaging 0.56
R8437:Sema3c UTSW 5 17,867,936 (GRCm39) missense probably damaging 0.99
R9174:Sema3c UTSW 5 17,868,039 (GRCm39) critical splice donor site probably null
R9295:Sema3c UTSW 5 17,932,495 (GRCm39) missense probably benign 0.09
R9599:Sema3c UTSW 5 17,919,452 (GRCm39) critical splice donor site probably null
R9702:Sema3c UTSW 5 17,858,828 (GRCm39) missense probably damaging 1.00
Z1176:Sema3c UTSW 5 17,932,517 (GRCm39) missense probably benign 0.04
Z1177:Sema3c UTSW 5 17,922,029 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGAAATCCATGGGTTTGTGGC -3'
(R):5'- TCCCTGAAAAGCTGAATGCC -3'

Sequencing Primer
(F):5'- CAACAGTTGTACGTGAGC -3'
(R):5'- GGTAAACATGGCTTCATTTTGCACTG -3'
Posted On 2022-06-15