Incidental Mutation 'R9477:March1'
ID 715867
Institutional Source Beutler Lab
Gene Symbol March1
Ensembl Gene ENSMUSG00000036469
Gene Name membrane-associated ring finger (C3HC4) 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock # R9477 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 65617900-66471637 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 66418890 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 102 (V102A)
Ref Sequence ENSEMBL: ENSMUSP00000105888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039540] [ENSMUST00000072482] [ENSMUST00000098708] [ENSMUST00000110253] [ENSMUST00000110255] [ENSMUST00000110256] [ENSMUST00000110258] [ENSMUST00000110259] [ENSMUST00000178982]
AlphaFold Q6NZQ8
Predicted Effect probably damaging
Transcript: ENSMUST00000039540
AA Change: V96A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044070
Gene: ENSMUSG00000036469
AA Change: V96A

DomainStartEndE-ValueType
RINGv 69 117 2.63e-22 SMART
transmembrane domain 145 167 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000072482
AA Change: V102A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072302
Gene: ENSMUSG00000036469
AA Change: V102A

DomainStartEndE-ValueType
low complexity region 25 54 N/A INTRINSIC
RINGv 75 123 2.63e-22 SMART
transmembrane domain 151 173 N/A INTRINSIC
transmembrane domain 193 215 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098708
AA Change: V106A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096305
Gene: ENSMUSG00000036469
AA Change: V106A

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
RINGv 79 127 2.63e-22 SMART
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110253
AA Change: V96A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105882
Gene: ENSMUSG00000036469
AA Change: V96A

DomainStartEndE-ValueType
RINGv 69 117 2.63e-22 SMART
transmembrane domain 145 167 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110255
AA Change: V106A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105884
Gene: ENSMUSG00000036469
AA Change: V106A

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
RINGv 79 127 2.63e-22 SMART
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110256
AA Change: V357A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105885
Gene: ENSMUSG00000036469
AA Change: V357A

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
low complexity region 111 125 N/A INTRINSIC
low complexity region 151 165 N/A INTRINSIC
RINGv 330 378 2.14e-22 SMART
transmembrane domain 406 428 N/A INTRINSIC
transmembrane domain 448 470 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110258
AA Change: V106A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105887
Gene: ENSMUSG00000036469
AA Change: V106A

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
RINGv 79 127 2.63e-22 SMART
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110259
AA Change: V102A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105888
Gene: ENSMUSG00000036469
AA Change: V102A

DomainStartEndE-ValueType
low complexity region 25 54 N/A INTRINSIC
RINGv 75 123 2.63e-22 SMART
transmembrane domain 151 173 N/A INTRINSIC
transmembrane domain 193 215 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152320
Predicted Effect probably damaging
Transcript: ENSMUST00000178982
AA Change: V106A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136545
Gene: ENSMUSG00000036469
AA Change: V106A

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
RINGv 79 127 2.63e-22 SMART
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Meta Mutation Damage Score 0.6043 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MARCH1 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). MARCH proteins add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their vesicular transport between membrane compartments. MARCH1 downregulates the surface expression of major histocompatibility complex (MHC) class II molecules (see MIM 142880) and other glycoproteins by directing them to the late endosomal/lysosomal compartment (Bartee et al., 2004 [PubMed 14722266]; Thibodeau et al., 2008 [PubMed 18389477]; De Gassart et al., 2008 [PubMed 18305173]).[supplied by OMIM, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal dendritic cell morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,152,840 F1263L probably damaging Het
Agap1 A T 1: 89,837,763 M618L probably benign Het
App C A 16: 85,056,504 A229S unknown Het
B020011L13Rik G T 1: 117,801,173 E137* probably null Het
BC034090 C T 1: 155,226,341 G59E probably damaging Het
C1ra A G 6: 124,522,496 D547G probably benign Het
Cdh2 A T 18: 16,622,155 D774E probably damaging Het
Cdon A G 9: 35,491,905 N1104D probably damaging Het
Cecr2 G A 6: 120,743,782 probably null Het
Ces2b A T 8: 104,833,924 N124Y probably damaging Het
Cfap61 A G 2: 146,143,112 T959A probably benign Het
Chaf1a A T 17: 56,062,244 K492* probably null Het
Clec14a A G 12: 58,267,834 V334A probably benign Het
Col6a3 A G 1: 90,778,899 I2771T unknown Het
Creb3 T C 4: 43,566,298 L244P probably damaging Het
Crispld1 T C 1: 17,746,732 V171A probably benign Het
Crmp1 T C 5: 37,288,838 Y613H probably damaging Het
Csrnp3 G A 2: 66,022,475 V416I probably benign Het
Dhrs1 A G 14: 55,739,411 V272A probably benign Het
Dip2b T C 15: 100,038,903 S32P probably damaging Het
Dpp10 G T 1: 123,376,641 T510K possibly damaging Het
Dst A G 1: 34,166,211 Y820C probably damaging Het
Fam3c A T 6: 22,308,480 M238K probably damaging Het
Fcrls A T 3: 87,252,496 C484S probably damaging Het
Fsd1 T C 17: 55,988,720 L97P possibly damaging Het
Gapdhs T C 7: 30,732,257 I310V probably damaging Het
Gimap4 A T 6: 48,690,380 N23I probably benign Het
Gm11639 A T 11: 104,945,872 H3562L unknown Het
Gm36079 A T 13: 120,026,746 I89N probably damaging Het
Gpr21 T A 2: 37,518,374 F311I probably damaging Het
Grm1 T C 10: 10,719,661 E741G probably benign Het
Gsto2 G A 19: 47,876,472 R148H probably benign Het
Gzmd A G 14: 56,131,356 V27A probably benign Het
Hbp1 A G 12: 31,930,767 C446R probably damaging Het
Hmcn2 A T 2: 31,396,019 probably null Het
Ifi205 G A 1: 174,026,589 T166I probably benign Het
Il23a T A 10: 128,298,053 probably benign Het
Itpr3 G A 17: 27,118,677 probably benign Het
Jag1 A T 2: 137,094,489 C362S probably damaging Het
Jmjd1c A T 10: 67,157,955 R72* probably null Het
Kcna6 A G 6: 126,739,398 I176T probably damaging Het
Mast1 T C 8: 84,912,150 K1517E probably benign Het
Mbnl1 A G 3: 60,613,348 D119G probably damaging Het
Mfsd8 A G 3: 40,830,622 probably null Het
Mtus2 T G 5: 148,077,930 V511G probably benign Het
Myot A C 18: 44,337,266 Q103H probably benign Het
Nrip2 G A 6: 128,400,182 D24N probably benign Het
Ntm T A 9: 29,411,626 S33C probably benign Het
Nus1 C T 10: 52,417,905 T55M possibly damaging Het
Olfr1217 G A 2: 89,023,271 T244I probably benign Het
Pik3cb C T 9: 99,040,920 probably null Het
Pogk T C 1: 166,399,835 N249S probably damaging Het
Pou1f1 C T 16: 65,523,617 T66I possibly damaging Het
Ppp1r42 T G 1: 9,985,629 K211N probably damaging Het
Ppp2r3d C A 9: 124,476,857 D2Y Het
Prdm5 A T 6: 65,794,358 N51I possibly damaging Het
Rif1 G A 2: 52,111,330 A1599T probably benign Het
Sema3c G A 5: 17,716,983 A520T Het
Shank1 G A 7: 44,312,918 S71N unknown Het
Spice1 T A 16: 44,376,820 N489K possibly damaging Het
Sptbn4 A G 7: 27,433,199 M116T possibly damaging Het
Supt5 T A 7: 28,326,075 N249Y probably damaging Het
Tex2 A G 11: 106,519,880 probably null Het
Trhde T A 10: 114,503,075 E610V probably benign Het
Trmt12 T C 15: 58,873,622 S290P possibly damaging Het
Trpm2 C T 10: 77,911,390 V1425M probably benign Het
Uaca T C 9: 60,870,826 S832P probably benign Het
Vcan T A 13: 89,693,009 D1472V probably damaging Het
Virma A G 4: 11,528,753 E1330G probably damaging Het
Vmn1r125 T G 7: 21,272,336 V53G possibly damaging Het
Vmn2r27 A T 6: 124,191,951 I740N probably damaging Het
Vmn2r70 C T 7: 85,569,036 C18Y possibly damaging Het
Zfp35 A G 18: 24,003,131 I177M possibly damaging Het
Zfp532 T C 18: 65,644,357 I895T probably benign Het
Zfp58 C A 13: 67,492,039 C111F probably damaging Het
Other mutations in March1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:March1 APN 8 66418877 missense possibly damaging 0.88
IGL02468:March1 APN 8 66418911 missense probably damaging 1.00
R0391:March1 UTSW 8 66418973 missense probably damaging 1.00
R1500:March1 UTSW 8 66468390 missense probably damaging 1.00
R1794:March1 UTSW 8 66386942 missense possibly damaging 0.63
R2015:March1 UTSW 8 66121821 missense probably damaging 0.99
R2184:March1 UTSW 8 66387423 missense probably benign 0.07
R2273:March1 UTSW 8 66387499 missense probably benign 0.15
R2274:March1 UTSW 8 66387499 missense probably benign 0.15
R2275:March1 UTSW 8 66387499 missense probably benign 0.15
R2314:March1 UTSW 8 66121790 start codon destroyed probably null 0.77
R3114:March1 UTSW 8 66387381 missense probably benign
R4458:March1 UTSW 8 66456171 missense probably damaging 1.00
R4656:March1 UTSW 8 66386419 missense probably benign 0.05
R4773:March1 UTSW 8 66387224 missense probably benign 0.03
R4838:March1 UTSW 8 66468363 missense probably damaging 1.00
R5073:March1 UTSW 8 66386368 missense probably benign 0.03
R5507:March1 UTSW 8 66418890 missense probably damaging 1.00
R5575:March1 UTSW 8 66468310 missense probably damaging 1.00
R5916:March1 UTSW 8 66387111 missense possibly damaging 0.89
R6931:March1 UTSW 8 66468492 missense probably benign 0.03
R7350:March1 UTSW 8 66468399 nonsense probably null
R7487:March1 UTSW 8 66456074 missense probably benign 0.14
R7531:March1 UTSW 8 66386337 missense probably benign
R7563:March1 UTSW 8 66468313 missense probably damaging 1.00
R7705:March1 UTSW 8 66468517 missense probably benign 0.00
R8142:March1 UTSW 8 66456126 missense probably benign 0.07
R8337:March1 UTSW 8 66418989 missense probably damaging 1.00
R8712:March1 UTSW 8 66468348 missense probably damaging 1.00
R9188:March1 UTSW 8 66456151 nonsense probably null
R9372:March1 UTSW 8 66468493 missense probably benign 0.01
R9790:March1 UTSW 8 66276687 missense probably benign 0.17
R9791:March1 UTSW 8 66276687 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TGATCAGAAGTTTGGGTCTACC -3'
(R):5'- GACATGAAGTTTGAAAGCAAGTCC -3'

Sequencing Primer
(F):5'- GACCATGAATTCTAGACTGTAGGTG -3'
(R):5'- AGCAAGTCCGCTTTGCAAG -3'
Posted On 2022-06-15