Incidental Mutation 'R9477:Dip2b'
ID 715891
Institutional Source Beutler Lab
Gene Symbol Dip2b
Ensembl Gene ENSMUSG00000023026
Gene Name disco interacting protein 2 homolog B
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.694) question?
Stock # R9477 (G1)
Quality Score 145.008
Status Not validated
Chromosome 15
Chromosomal Location 100038664-100219473 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 100038903 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 32 (S32P)
Ref Sequence ENSEMBL: ENSMUSP00000097777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100203]
AlphaFold Q3UH60
Predicted Effect probably damaging
Transcript: ENSMUST00000100203
AA Change: S32P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026
AA Change: S32P

DomainStartEndE-ValueType
DMAP_binding 12 130 1e-42 SMART
low complexity region 152 168 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
Pfam:AMP-binding 341 817 2e-26 PFAM
Pfam:AMP-binding 993 1468 1.8e-64 PFAM
low complexity region 1532 1544 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,152,840 F1263L probably damaging Het
Agap1 A T 1: 89,837,763 M618L probably benign Het
App C A 16: 85,056,504 A229S unknown Het
B020011L13Rik G T 1: 117,801,173 E137* probably null Het
BC034090 C T 1: 155,226,341 G59E probably damaging Het
C1ra A G 6: 124,522,496 D547G probably benign Het
Cdh2 A T 18: 16,622,155 D774E probably damaging Het
Cdon A G 9: 35,491,905 N1104D probably damaging Het
Cecr2 G A 6: 120,743,782 probably null Het
Ces2b A T 8: 104,833,924 N124Y probably damaging Het
Cfap61 A G 2: 146,143,112 T959A probably benign Het
Chaf1a A T 17: 56,062,244 K492* probably null Het
Clec14a A G 12: 58,267,834 V334A probably benign Het
Col6a3 A G 1: 90,778,899 I2771T unknown Het
Creb3 T C 4: 43,566,298 L244P probably damaging Het
Crispld1 T C 1: 17,746,732 V171A probably benign Het
Crmp1 T C 5: 37,288,838 Y613H probably damaging Het
Csrnp3 G A 2: 66,022,475 V416I probably benign Het
Dhrs1 A G 14: 55,739,411 V272A probably benign Het
Dpp10 G T 1: 123,376,641 T510K possibly damaging Het
Dst A G 1: 34,166,211 Y820C probably damaging Het
Fam3c A T 6: 22,308,480 M238K probably damaging Het
Fcrls A T 3: 87,252,496 C484S probably damaging Het
Fsd1 T C 17: 55,988,720 L97P possibly damaging Het
Gapdhs T C 7: 30,732,257 I310V probably damaging Het
Gimap4 A T 6: 48,690,380 N23I probably benign Het
Gm11639 A T 11: 104,945,872 H3562L unknown Het
Gm36079 A T 13: 120,026,746 I89N probably damaging Het
Gpr21 T A 2: 37,518,374 F311I probably damaging Het
Grm1 T C 10: 10,719,661 E741G probably benign Het
Gsto2 G A 19: 47,876,472 R148H probably benign Het
Gzmd A G 14: 56,131,356 V27A probably benign Het
Hbp1 A G 12: 31,930,767 C446R probably damaging Het
Hmcn2 A T 2: 31,396,019 probably null Het
Ifi205 G A 1: 174,026,589 T166I probably benign Het
Il23a T A 10: 128,298,053 probably benign Het
Itpr3 G A 17: 27,118,677 probably benign Het
Jag1 A T 2: 137,094,489 C362S probably damaging Het
Jmjd1c A T 10: 67,157,955 R72* probably null Het
Kcna6 A G 6: 126,739,398 I176T probably damaging Het
March1 T C 8: 66,418,890 V102A probably damaging Het
Mast1 T C 8: 84,912,150 K1517E probably benign Het
Mbnl1 A G 3: 60,613,348 D119G probably damaging Het
Mfsd8 A G 3: 40,830,622 probably null Het
Mtus2 T G 5: 148,077,930 V511G probably benign Het
Myot A C 18: 44,337,266 Q103H probably benign Het
Nrip2 G A 6: 128,400,182 D24N probably benign Het
Ntm T A 9: 29,411,626 S33C probably benign Het
Nus1 C T 10: 52,417,905 T55M possibly damaging Het
Olfr1217 G A 2: 89,023,271 T244I probably benign Het
Pik3cb C T 9: 99,040,920 probably null Het
Pogk T C 1: 166,399,835 N249S probably damaging Het
Pou1f1 C T 16: 65,523,617 T66I possibly damaging Het
Ppp1r42 T G 1: 9,985,629 K211N probably damaging Het
Ppp2r3d C A 9: 124,476,857 D2Y Het
Prdm5 A T 6: 65,794,358 N51I possibly damaging Het
Rif1 G A 2: 52,111,330 A1599T probably benign Het
Sema3c G A 5: 17,716,983 A520T Het
Shank1 G A 7: 44,312,918 S71N unknown Het
Spice1 T A 16: 44,376,820 N489K possibly damaging Het
Sptbn4 A G 7: 27,433,199 M116T possibly damaging Het
Supt5 T A 7: 28,326,075 N249Y probably damaging Het
Tex2 A G 11: 106,519,880 probably null Het
Trhde T A 10: 114,503,075 E610V probably benign Het
Trmt12 T C 15: 58,873,622 S290P possibly damaging Het
Trpm2 C T 10: 77,911,390 V1425M probably benign Het
Uaca T C 9: 60,870,826 S832P probably benign Het
Vcan T A 13: 89,693,009 D1472V probably damaging Het
Virma A G 4: 11,528,753 E1330G probably damaging Het
Vmn1r125 T G 7: 21,272,336 V53G possibly damaging Het
Vmn2r27 A T 6: 124,191,951 I740N probably damaging Het
Vmn2r70 C T 7: 85,569,036 C18Y possibly damaging Het
Zfp35 A G 18: 24,003,131 I177M possibly damaging Het
Zfp532 T C 18: 65,644,357 I895T probably benign Het
Zfp58 C A 13: 67,492,039 C111F probably damaging Het
Other mutations in Dip2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dip2b APN 15 100174501 missense probably damaging 1.00
IGL01716:Dip2b APN 15 100209636 missense probably benign 0.00
IGL01893:Dip2b APN 15 100171220 splice site probably benign
IGL01915:Dip2b APN 15 100178511 missense probably damaging 1.00
IGL02125:Dip2b APN 15 100186250 missense possibly damaging 0.60
IGL02200:Dip2b APN 15 100151202 missense possibly damaging 0.93
IGL02506:Dip2b APN 15 100157281 missense probably damaging 1.00
IGL02571:Dip2b APN 15 100157885 missense possibly damaging 0.93
IGL02706:Dip2b APN 15 100215311 missense probably damaging 0.98
IGL02983:Dip2b APN 15 100132022 missense possibly damaging 0.81
IGL03120:Dip2b APN 15 100203127 splice site probably benign
IGL03181:Dip2b APN 15 100215207 missense probably damaging 0.98
IGL03229:Dip2b APN 15 100207838 splice site probably benign
IGL03399:Dip2b APN 15 100175327 missense possibly damaging 0.63
PIT4131001:Dip2b UTSW 15 100202352 missense probably damaging 1.00
R0009:Dip2b UTSW 15 100169312 missense probably damaging 1.00
R0058:Dip2b UTSW 15 100215240 missense probably benign 0.03
R0058:Dip2b UTSW 15 100215240 missense probably benign 0.03
R0092:Dip2b UTSW 15 100202265 missense probably damaging 1.00
R0201:Dip2b UTSW 15 100186147 missense probably damaging 0.98
R0359:Dip2b UTSW 15 100211993 missense probably damaging 0.98
R0390:Dip2b UTSW 15 100193913 missense probably damaging 0.99
R0564:Dip2b UTSW 15 100162719 nonsense probably null
R0730:Dip2b UTSW 15 100171651 missense probably damaging 1.00
R1144:Dip2b UTSW 15 100154250 missense probably benign 0.11
R1200:Dip2b UTSW 15 100209745 missense probably benign 0.00
R1506:Dip2b UTSW 15 100183113 missense probably damaging 1.00
R1750:Dip2b UTSW 15 100178466 missense probably benign
R1760:Dip2b UTSW 15 100212029 missense probably damaging 1.00
R1773:Dip2b UTSW 15 100193961 missense probably benign 0.00
R1812:Dip2b UTSW 15 100198938 splice site probably null
R2264:Dip2b UTSW 15 100203216 missense probably benign 0.05
R3105:Dip2b UTSW 15 100142137 nonsense probably null
R4029:Dip2b UTSW 15 100186172 missense probably damaging 1.00
R4030:Dip2b UTSW 15 100186172 missense probably damaging 1.00
R4296:Dip2b UTSW 15 100181336 missense probably benign
R4392:Dip2b UTSW 15 100162036 missense probably damaging 1.00
R4480:Dip2b UTSW 15 100186301 missense probably damaging 0.99
R4564:Dip2b UTSW 15 100157258 nonsense probably null
R4605:Dip2b UTSW 15 100209636 missense probably benign 0.00
R4606:Dip2b UTSW 15 100215329 missense possibly damaging 0.91
R4634:Dip2b UTSW 15 100160491 missense probably damaging 1.00
R4667:Dip2b UTSW 15 100151360 missense probably benign 0.01
R4739:Dip2b UTSW 15 100207777 missense probably damaging 0.98
R4826:Dip2b UTSW 15 100169281 missense probably damaging 0.99
R4870:Dip2b UTSW 15 100195784 splice site probably null
R4877:Dip2b UTSW 15 100160529 missense possibly damaging 0.49
R4932:Dip2b UTSW 15 100171722 missense probably damaging 1.00
R5009:Dip2b UTSW 15 100195784 splice site probably null
R5169:Dip2b UTSW 15 100205113 missense probably damaging 1.00
R5216:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5218:Dip2b UTSW 15 100154296 missense probably benign 0.00
R5274:Dip2b UTSW 15 100212104 missense possibly damaging 0.54
R5370:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5420:Dip2b UTSW 15 100205173 intron probably benign
R5447:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5670:Dip2b UTSW 15 100190104 missense possibly damaging 0.80
R5768:Dip2b UTSW 15 100157945 missense probably benign 0.32
R5908:Dip2b UTSW 15 100151184 missense possibly damaging 0.93
R5957:Dip2b UTSW 15 100209694 missense probably benign 0.03
R5987:Dip2b UTSW 15 100190079 missense probably damaging 1.00
R6260:Dip2b UTSW 15 100162702 missense probably benign 0.05
R6325:Dip2b UTSW 15 100154282 missense probably benign 0.00
R6367:Dip2b UTSW 15 100115914 missense possibly damaging 0.50
R6391:Dip2b UTSW 15 100151276 missense probably damaging 1.00
R6422:Dip2b UTSW 15 100199011 missense probably damaging 0.98
R6818:Dip2b UTSW 15 100193954 missense probably benign 0.09
R6922:Dip2b UTSW 15 100193843 missense probably benign 0.25
R7002:Dip2b UTSW 15 100160465 missense probably benign 0.43
R7076:Dip2b UTSW 15 100157972 splice site probably null
R7176:Dip2b UTSW 15 100169318 missense probably damaging 1.00
R7255:Dip2b UTSW 15 100209627 missense probably benign 0.00
R7463:Dip2b UTSW 15 100154157 missense probably benign
R7513:Dip2b UTSW 15 100207748 splice site probably null
R7876:Dip2b UTSW 15 100191041 missense probably benign 0.02
R8368:Dip2b UTSW 15 100154243 missense probably benign 0.00
R9289:Dip2b UTSW 15 100173271 missense probably damaging 0.97
R9405:Dip2b UTSW 15 100195876 missense probably benign 0.05
R9485:Dip2b UTSW 15 100155043 missense probably benign 0.05
R9533:Dip2b UTSW 15 100175297 missense probably benign 0.06
R9581:Dip2b UTSW 15 100181374 missense probably damaging 0.99
R9666:Dip2b UTSW 15 100209580 missense probably damaging 1.00
X0064:Dip2b UTSW 15 100115850 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCTTCCCAAGGAGAGCAGAG -3'
(R):5'- AGCTTTGTCTCCAGCTGAC -3'

Sequencing Primer
(F):5'- TCTCCAAGATCCGCGGTAGAG -3'
(R):5'- GTCTCCAGCTGACCCGTC -3'
Posted On 2022-06-15