Incidental Mutation 'R9477:Dip2b'
ID 715891
Institutional Source Beutler Lab
Gene Symbol Dip2b
Ensembl Gene ENSMUSG00000023026
Gene Name disco interacting protein 2 homolog B
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.615) question?
Stock # R9477 (G1)
Quality Score 145.008
Status Not validated
Chromosome 15
Chromosomal Location 99936545-100117354 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 99936784 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 32 (S32P)
Ref Sequence ENSEMBL: ENSMUSP00000097777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100203]
AlphaFold Q3UH60
Predicted Effect probably damaging
Transcript: ENSMUST00000100203
AA Change: S32P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026
AA Change: S32P

DomainStartEndE-ValueType
DMAP_binding 12 130 1e-42 SMART
low complexity region 152 168 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
Pfam:AMP-binding 341 817 2e-26 PFAM
Pfam:AMP-binding 993 1468 1.8e-64 PFAM
low complexity region 1532 1544 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A T 1: 89,765,485 (GRCm39) M618L probably benign Het
Anxa2r2 A T 13: 120,488,282 (GRCm39) I89N probably damaging Het
App C A 16: 84,853,392 (GRCm39) A229S unknown Het
B020011L13Rik G T 1: 117,728,903 (GRCm39) E137* probably null Het
BC034090 C T 1: 155,102,087 (GRCm39) G59E probably damaging Het
C1ra A G 6: 124,499,455 (GRCm39) D547G probably benign Het
Cdh2 A T 18: 16,755,212 (GRCm39) D774E probably damaging Het
Cdon A G 9: 35,403,201 (GRCm39) N1104D probably damaging Het
Cecr2 G A 6: 120,720,743 (GRCm39) probably null Het
Ces2b A T 8: 105,560,556 (GRCm39) N124Y probably damaging Het
Cfap61 A G 2: 145,985,032 (GRCm39) T959A probably benign Het
Chaf1a A T 17: 56,369,244 (GRCm39) K492* probably null Het
Clec14a A G 12: 58,314,620 (GRCm39) V334A probably benign Het
Col6a3 A G 1: 90,706,621 (GRCm39) I2771T unknown Het
Creb3 T C 4: 43,566,298 (GRCm39) L244P probably damaging Het
Crispld1 T C 1: 17,816,956 (GRCm39) V171A probably benign Het
Crmp1 T C 5: 37,446,182 (GRCm39) Y613H probably damaging Het
Csrnp3 G A 2: 65,852,819 (GRCm39) V416I probably benign Het
Dhrs1 A G 14: 55,976,868 (GRCm39) V272A probably benign Het
Dpp10 G T 1: 123,304,370 (GRCm39) T510K possibly damaging Het
Dst A G 1: 34,205,292 (GRCm39) Y820C probably damaging Het
Efcab3 A T 11: 104,836,698 (GRCm39) H3562L unknown Het
Fam3c A T 6: 22,308,479 (GRCm39) M238K probably damaging Het
Fcgbpl1 T C 7: 27,852,265 (GRCm39) F1263L probably damaging Het
Fcrl2 A T 3: 87,159,803 (GRCm39) C484S probably damaging Het
Fsd1 T C 17: 56,295,720 (GRCm39) L97P possibly damaging Het
Gapdhs T C 7: 30,431,682 (GRCm39) I310V probably damaging Het
Gimap4 A T 6: 48,667,314 (GRCm39) N23I probably benign Het
Gpr21 T A 2: 37,408,386 (GRCm39) F311I probably damaging Het
Grm1 T C 10: 10,595,405 (GRCm39) E741G probably benign Het
Gsto2 G A 19: 47,864,911 (GRCm39) R148H probably benign Het
Gzmd A G 14: 56,368,813 (GRCm39) V27A probably benign Het
Hbp1 A G 12: 31,980,766 (GRCm39) C446R probably damaging Het
Hmcn2 A T 2: 31,286,031 (GRCm39) probably null Het
Ifi205 G A 1: 173,854,155 (GRCm39) T166I probably benign Het
Il23a T A 10: 128,133,922 (GRCm39) probably benign Het
Itpr3 G A 17: 27,337,651 (GRCm39) probably benign Het
Jag1 A T 2: 136,936,409 (GRCm39) C362S probably damaging Het
Jmjd1c A T 10: 66,993,734 (GRCm39) R72* probably null Het
Kcna6 A G 6: 126,716,361 (GRCm39) I176T probably damaging Het
Marchf1 T C 8: 66,871,542 (GRCm39) V102A probably damaging Het
Mast1 T C 8: 85,638,779 (GRCm39) K1517E probably benign Het
Mbnl1 A G 3: 60,520,769 (GRCm39) D119G probably damaging Het
Mfsd8 A G 3: 40,785,057 (GRCm39) probably null Het
Mtus2 T G 5: 148,014,740 (GRCm39) V511G probably benign Het
Myot A C 18: 44,470,333 (GRCm39) Q103H probably benign Het
Nrip2 G A 6: 128,377,145 (GRCm39) D24N probably benign Het
Ntm T A 9: 29,322,922 (GRCm39) S33C probably benign Het
Nus1 C T 10: 52,294,001 (GRCm39) T55M possibly damaging Het
Or4c112 G A 2: 88,853,615 (GRCm39) T244I probably benign Het
Pik3cb C T 9: 98,922,973 (GRCm39) probably null Het
Pogk T C 1: 166,227,404 (GRCm39) N249S probably damaging Het
Pou1f1 C T 16: 65,320,503 (GRCm39) T66I possibly damaging Het
Ppp1r42 T G 1: 10,055,854 (GRCm39) K211N probably damaging Het
Ppp2r3d C A 9: 124,476,857 (GRCm38) D2Y Het
Prdm5 A T 6: 65,771,342 (GRCm39) N51I possibly damaging Het
Rif1 G A 2: 52,001,342 (GRCm39) A1599T probably benign Het
Sema3c G A 5: 17,921,981 (GRCm39) A520T Het
Shank1 G A 7: 43,962,342 (GRCm39) S71N unknown Het
Spice1 T A 16: 44,197,183 (GRCm39) N489K possibly damaging Het
Sptbn4 A G 7: 27,132,624 (GRCm39) M116T possibly damaging Het
Supt5 T A 7: 28,025,500 (GRCm39) N249Y probably damaging Het
Tex2 A G 11: 106,410,706 (GRCm39) probably null Het
Trhde T A 10: 114,338,980 (GRCm39) E610V probably benign Het
Trmt12 T C 15: 58,745,471 (GRCm39) S290P possibly damaging Het
Trpm2 C T 10: 77,747,224 (GRCm39) V1425M probably benign Het
Uaca T C 9: 60,778,108 (GRCm39) S832P probably benign Het
Vcan T A 13: 89,841,128 (GRCm39) D1472V probably damaging Het
Virma A G 4: 11,528,753 (GRCm39) E1330G probably damaging Het
Vmn1r125 T G 7: 21,006,261 (GRCm39) V53G possibly damaging Het
Vmn2r27 A T 6: 124,168,910 (GRCm39) I740N probably damaging Het
Vmn2r70 C T 7: 85,218,244 (GRCm39) C18Y possibly damaging Het
Zfp35 A G 18: 24,136,188 (GRCm39) I177M possibly damaging Het
Zfp532 T C 18: 65,777,428 (GRCm39) I895T probably benign Het
Zfp58 C A 13: 67,640,158 (GRCm39) C111F probably damaging Het
Other mutations in Dip2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dip2b APN 15 100,072,382 (GRCm39) missense probably damaging 1.00
IGL01716:Dip2b APN 15 100,107,517 (GRCm39) missense probably benign 0.00
IGL01893:Dip2b APN 15 100,069,101 (GRCm39) splice site probably benign
IGL01915:Dip2b APN 15 100,076,392 (GRCm39) missense probably damaging 1.00
IGL02125:Dip2b APN 15 100,084,131 (GRCm39) missense possibly damaging 0.60
IGL02200:Dip2b APN 15 100,049,083 (GRCm39) missense possibly damaging 0.93
IGL02506:Dip2b APN 15 100,055,162 (GRCm39) missense probably damaging 1.00
IGL02571:Dip2b APN 15 100,055,766 (GRCm39) missense possibly damaging 0.93
IGL02706:Dip2b APN 15 100,113,192 (GRCm39) missense probably damaging 0.98
IGL02983:Dip2b APN 15 100,029,903 (GRCm39) missense possibly damaging 0.81
IGL03120:Dip2b APN 15 100,101,008 (GRCm39) splice site probably benign
IGL03181:Dip2b APN 15 100,113,088 (GRCm39) missense probably damaging 0.98
IGL03229:Dip2b APN 15 100,105,719 (GRCm39) splice site probably benign
IGL03399:Dip2b APN 15 100,073,208 (GRCm39) missense possibly damaging 0.63
PIT4131001:Dip2b UTSW 15 100,100,233 (GRCm39) missense probably damaging 1.00
R0009:Dip2b UTSW 15 100,067,193 (GRCm39) missense probably damaging 1.00
R0058:Dip2b UTSW 15 100,113,121 (GRCm39) missense probably benign 0.03
R0058:Dip2b UTSW 15 100,113,121 (GRCm39) missense probably benign 0.03
R0092:Dip2b UTSW 15 100,100,146 (GRCm39) missense probably damaging 1.00
R0201:Dip2b UTSW 15 100,084,028 (GRCm39) missense probably damaging 0.98
R0359:Dip2b UTSW 15 100,109,874 (GRCm39) missense probably damaging 0.98
R0390:Dip2b UTSW 15 100,091,794 (GRCm39) missense probably damaging 0.99
R0564:Dip2b UTSW 15 100,060,600 (GRCm39) nonsense probably null
R0730:Dip2b UTSW 15 100,069,532 (GRCm39) missense probably damaging 1.00
R1144:Dip2b UTSW 15 100,052,131 (GRCm39) missense probably benign 0.11
R1200:Dip2b UTSW 15 100,107,626 (GRCm39) missense probably benign 0.00
R1506:Dip2b UTSW 15 100,080,994 (GRCm39) missense probably damaging 1.00
R1750:Dip2b UTSW 15 100,076,347 (GRCm39) missense probably benign
R1760:Dip2b UTSW 15 100,109,910 (GRCm39) missense probably damaging 1.00
R1773:Dip2b UTSW 15 100,091,842 (GRCm39) missense probably benign 0.00
R1812:Dip2b UTSW 15 100,096,819 (GRCm39) splice site probably null
R2264:Dip2b UTSW 15 100,101,097 (GRCm39) missense probably benign 0.05
R3105:Dip2b UTSW 15 100,040,018 (GRCm39) nonsense probably null
R4029:Dip2b UTSW 15 100,084,053 (GRCm39) missense probably damaging 1.00
R4030:Dip2b UTSW 15 100,084,053 (GRCm39) missense probably damaging 1.00
R4296:Dip2b UTSW 15 100,079,217 (GRCm39) missense probably benign
R4392:Dip2b UTSW 15 100,059,917 (GRCm39) missense probably damaging 1.00
R4480:Dip2b UTSW 15 100,084,182 (GRCm39) missense probably damaging 0.99
R4564:Dip2b UTSW 15 100,055,139 (GRCm39) nonsense probably null
R4605:Dip2b UTSW 15 100,107,517 (GRCm39) missense probably benign 0.00
R4606:Dip2b UTSW 15 100,113,210 (GRCm39) missense possibly damaging 0.91
R4634:Dip2b UTSW 15 100,058,372 (GRCm39) missense probably damaging 1.00
R4667:Dip2b UTSW 15 100,049,241 (GRCm39) missense probably benign 0.01
R4739:Dip2b UTSW 15 100,105,658 (GRCm39) missense probably damaging 0.98
R4826:Dip2b UTSW 15 100,067,162 (GRCm39) missense probably damaging 0.99
R4870:Dip2b UTSW 15 100,093,665 (GRCm39) splice site probably null
R4877:Dip2b UTSW 15 100,058,410 (GRCm39) missense possibly damaging 0.49
R4932:Dip2b UTSW 15 100,069,603 (GRCm39) missense probably damaging 1.00
R5009:Dip2b UTSW 15 100,093,665 (GRCm39) splice site probably null
R5169:Dip2b UTSW 15 100,102,994 (GRCm39) missense probably damaging 1.00
R5216:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5218:Dip2b UTSW 15 100,052,177 (GRCm39) missense probably benign 0.00
R5274:Dip2b UTSW 15 100,109,985 (GRCm39) missense possibly damaging 0.54
R5370:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5420:Dip2b UTSW 15 100,103,054 (GRCm39) intron probably benign
R5447:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5670:Dip2b UTSW 15 100,087,985 (GRCm39) missense possibly damaging 0.80
R5768:Dip2b UTSW 15 100,055,826 (GRCm39) missense probably benign 0.32
R5908:Dip2b UTSW 15 100,049,065 (GRCm39) missense possibly damaging 0.93
R5957:Dip2b UTSW 15 100,107,575 (GRCm39) missense probably benign 0.03
R5987:Dip2b UTSW 15 100,087,960 (GRCm39) missense probably damaging 1.00
R6260:Dip2b UTSW 15 100,060,583 (GRCm39) missense probably benign 0.05
R6325:Dip2b UTSW 15 100,052,163 (GRCm39) missense probably benign 0.00
R6367:Dip2b UTSW 15 100,013,795 (GRCm39) missense possibly damaging 0.50
R6391:Dip2b UTSW 15 100,049,157 (GRCm39) missense probably damaging 1.00
R6422:Dip2b UTSW 15 100,096,892 (GRCm39) missense probably damaging 0.98
R6818:Dip2b UTSW 15 100,091,835 (GRCm39) missense probably benign 0.09
R6922:Dip2b UTSW 15 100,091,724 (GRCm39) missense probably benign 0.25
R7002:Dip2b UTSW 15 100,058,346 (GRCm39) missense probably benign 0.43
R7076:Dip2b UTSW 15 100,055,853 (GRCm39) splice site probably null
R7176:Dip2b UTSW 15 100,067,199 (GRCm39) missense probably damaging 1.00
R7255:Dip2b UTSW 15 100,107,508 (GRCm39) missense probably benign 0.00
R7463:Dip2b UTSW 15 100,052,038 (GRCm39) missense probably benign
R7513:Dip2b UTSW 15 100,105,629 (GRCm39) splice site probably null
R7876:Dip2b UTSW 15 100,088,922 (GRCm39) missense probably benign 0.02
R8368:Dip2b UTSW 15 100,052,124 (GRCm39) missense probably benign 0.00
R9289:Dip2b UTSW 15 100,071,152 (GRCm39) missense probably damaging 0.97
R9405:Dip2b UTSW 15 100,093,757 (GRCm39) missense probably benign 0.05
R9485:Dip2b UTSW 15 100,052,924 (GRCm39) missense probably benign 0.05
R9533:Dip2b UTSW 15 100,073,178 (GRCm39) missense probably benign 0.06
R9581:Dip2b UTSW 15 100,079,255 (GRCm39) missense probably damaging 0.99
R9666:Dip2b UTSW 15 100,107,461 (GRCm39) missense probably damaging 1.00
X0064:Dip2b UTSW 15 100,013,731 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCTTCCCAAGGAGAGCAGAG -3'
(R):5'- AGCTTTGTCTCCAGCTGAC -3'

Sequencing Primer
(F):5'- TCTCCAAGATCCGCGGTAGAG -3'
(R):5'- GTCTCCAGCTGACCCGTC -3'
Posted On 2022-06-15