Incidental Mutation 'R9477:Itpr3'
ID 715895
Institutional Source Beutler Lab
Gene Symbol Itpr3
Ensembl Gene ENSMUSG00000042644
Gene Name inositol 1,4,5-triphosphate receptor 3
Synonyms tf, Ip3r3, Itpr-3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9477 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 27057304-27122223 bp(+) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) G to A at 27118677 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025045] [ENSMUST00000049308] [ENSMUST00000118613] [ENSMUST00000119227]
AlphaFold P70227
Predicted Effect probably benign
Transcript: ENSMUST00000025045
Predicted Effect probably null
Transcript: ENSMUST00000049308
SMART Domains Protein: ENSMUSP00000038150
Gene: ENSMUSG00000042644

DomainStartEndE-ValueType
MIR 113 167 7.75e-6 SMART
MIR 174 224 1.16e-4 SMART
MIR 232 288 1.21e-7 SMART
MIR 295 402 9.38e-14 SMART
Pfam:RYDR_ITPR 473 670 7.8e-64 PFAM
low complexity region 881 889 N/A INTRINSIC
Pfam:RYDR_ITPR 1175 1333 5.8e-16 PFAM
low complexity region 1549 1567 N/A INTRINSIC
low complexity region 1831 1851 N/A INTRINSIC
Pfam:RIH_assoc 1863 1973 2.6e-34 PFAM
transmembrane domain 2203 2225 N/A INTRINSIC
Pfam:Ion_trans 2235 2527 8.1e-20 PFAM
coiled coil region 2631 2660 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118613
Predicted Effect probably benign
Transcript: ENSMUST00000119227
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for inositol 1,4,5-trisphosphate, a second messenger that mediates the release of intracellular calcium. The receptor contains a calcium channel at the C-terminus and the ligand-binding site at the N-terminus. Knockout studies in mice suggest that type 2 and type 3 inositol 1,4,5-trisphosphate receptors play a key role in exocrine secretion underlying energy metabolism and growth. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and exhibit no apparent abnormalities in pancreatic and salivary secretion. However, one mutation in this gene results in alternating abnormal hair loss and normal hair growth throughout the life of the mouse and low sweet preference. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,152,840 F1263L probably damaging Het
Agap1 A T 1: 89,837,763 M618L probably benign Het
App C A 16: 85,056,504 A229S unknown Het
B020011L13Rik G T 1: 117,801,173 E137* probably null Het
BC034090 C T 1: 155,226,341 G59E probably damaging Het
C1ra A G 6: 124,522,496 D547G probably benign Het
Cdh2 A T 18: 16,622,155 D774E probably damaging Het
Cdon A G 9: 35,491,905 N1104D probably damaging Het
Cecr2 G A 6: 120,743,782 probably null Het
Ces2b A T 8: 104,833,924 N124Y probably damaging Het
Cfap61 A G 2: 146,143,112 T959A probably benign Het
Chaf1a A T 17: 56,062,244 K492* probably null Het
Clec14a A G 12: 58,267,834 V334A probably benign Het
Col6a3 A G 1: 90,778,899 I2771T unknown Het
Creb3 T C 4: 43,566,298 L244P probably damaging Het
Crispld1 T C 1: 17,746,732 V171A probably benign Het
Crmp1 T C 5: 37,288,838 Y613H probably damaging Het
Csrnp3 G A 2: 66,022,475 V416I probably benign Het
Dhrs1 A G 14: 55,739,411 V272A probably benign Het
Dip2b T C 15: 100,038,903 S32P probably damaging Het
Dpp10 G T 1: 123,376,641 T510K possibly damaging Het
Dst A G 1: 34,166,211 Y820C probably damaging Het
Fam3c A T 6: 22,308,480 M238K probably damaging Het
Fcrls A T 3: 87,252,496 C484S probably damaging Het
Fsd1 T C 17: 55,988,720 L97P possibly damaging Het
Gapdhs T C 7: 30,732,257 I310V probably damaging Het
Gimap4 A T 6: 48,690,380 N23I probably benign Het
Gm11639 A T 11: 104,945,872 H3562L unknown Het
Gm36079 A T 13: 120,026,746 I89N probably damaging Het
Gpr21 T A 2: 37,518,374 F311I probably damaging Het
Grm1 T C 10: 10,719,661 E741G probably benign Het
Gsto2 G A 19: 47,876,472 R148H probably benign Het
Gzmd A G 14: 56,131,356 V27A probably benign Het
Hbp1 A G 12: 31,930,767 C446R probably damaging Het
Hmcn2 A T 2: 31,396,019 probably null Het
Ifi205 G A 1: 174,026,589 T166I probably benign Het
Il23a T A 10: 128,298,053 probably benign Het
Jag1 A T 2: 137,094,489 C362S probably damaging Het
Jmjd1c A T 10: 67,157,955 R72* probably null Het
Kcna6 A G 6: 126,739,398 I176T probably damaging Het
March1 T C 8: 66,418,890 V102A probably damaging Het
Mast1 T C 8: 84,912,150 K1517E probably benign Het
Mbnl1 A G 3: 60,613,348 D119G probably damaging Het
Mfsd8 A G 3: 40,830,622 probably null Het
Mtus2 T G 5: 148,077,930 V511G probably benign Het
Myot A C 18: 44,337,266 Q103H probably benign Het
Nrip2 G A 6: 128,400,182 D24N probably benign Het
Ntm T A 9: 29,411,626 S33C probably benign Het
Nus1 C T 10: 52,417,905 T55M possibly damaging Het
Olfr1217 G A 2: 89,023,271 T244I probably benign Het
Pik3cb C T 9: 99,040,920 probably null Het
Pogk T C 1: 166,399,835 N249S probably damaging Het
Pou1f1 C T 16: 65,523,617 T66I possibly damaging Het
Ppp1r42 T G 1: 9,985,629 K211N probably damaging Het
Ppp2r3d C A 9: 124,476,857 D2Y Het
Prdm5 A T 6: 65,794,358 N51I possibly damaging Het
Rif1 G A 2: 52,111,330 A1599T probably benign Het
Sema3c G A 5: 17,716,983 A520T Het
Shank1 G A 7: 44,312,918 S71N unknown Het
Spice1 T A 16: 44,376,820 N489K possibly damaging Het
Sptbn4 A G 7: 27,433,199 M116T possibly damaging Het
Supt5 T A 7: 28,326,075 N249Y probably damaging Het
Tex2 A G 11: 106,519,880 probably null Het
Trhde T A 10: 114,503,075 E610V probably benign Het
Trmt12 T C 15: 58,873,622 S290P possibly damaging Het
Trpm2 C T 10: 77,911,390 V1425M probably benign Het
Uaca T C 9: 60,870,826 S832P probably benign Het
Vcan T A 13: 89,693,009 D1472V probably damaging Het
Virma A G 4: 11,528,753 E1330G probably damaging Het
Vmn1r125 T G 7: 21,272,336 V53G possibly damaging Het
Vmn2r27 A T 6: 124,191,951 I740N probably damaging Het
Vmn2r70 C T 7: 85,569,036 C18Y possibly damaging Het
Zfp35 A G 18: 24,003,131 I177M possibly damaging Het
Zfp532 T C 18: 65,644,357 I895T probably benign Het
Zfp58 C A 13: 67,492,039 C111F probably damaging Het
Other mutations in Itpr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Itpr3 APN 17 27083629 missense probably benign 0.05
IGL00980:Itpr3 APN 17 27110956 missense probably benign
IGL01151:Itpr3 APN 17 27091529 missense probably damaging 1.00
IGL01289:Itpr3 APN 17 27099765 missense probably damaging 0.99
IGL01403:Itpr3 APN 17 27118595 missense probably damaging 0.97
IGL01666:Itpr3 APN 17 27117178 missense probably benign 0.02
IGL01897:Itpr3 APN 17 27111262 missense probably damaging 1.00
IGL02003:Itpr3 APN 17 27121475 missense probably damaging 1.00
IGL02012:Itpr3 APN 17 27104095 missense probably benign
IGL02063:Itpr3 APN 17 27120023 missense probably benign 0.01
IGL02146:Itpr3 APN 17 27117275 missense probably damaging 1.00
IGL02158:Itpr3 APN 17 27098442 missense probably damaging 1.00
IGL02177:Itpr3 APN 17 27099614 missense possibly damaging 0.74
IGL02247:Itpr3 APN 17 27098179 missense probably damaging 1.00
IGL02606:Itpr3 APN 17 27114512 splice site probably benign
IGL02651:Itpr3 APN 17 27106398 missense probably damaging 0.99
IGL02902:Itpr3 APN 17 27104556 missense probably benign 0.21
IGL03001:Itpr3 APN 17 27089612 splice site probably benign
IGL03004:Itpr3 APN 17 27097978 missense possibly damaging 0.90
IGL03065:Itpr3 APN 17 27091933 missense probably damaging 1.00
IGL03117:Itpr3 APN 17 27119266 missense probably damaging 1.00
IGL03181:Itpr3 APN 17 27111268 missense probably benign
IGL03404:Itpr3 APN 17 27091518 missense probably damaging 1.00
Allure UTSW 17 27107303 missense probably damaging 1.00
alopecia UTSW 17 27095478 missense probably damaging 0.98
Beauty UTSW 17 27106342 missense probably damaging 1.00
Opuesto UTSW 17 27087592 missense probably damaging 1.00
Paradox UTSW 17 27098171 missense probably damaging 1.00
Pulchritude UTSW 17 27086960 missense probably damaging 0.97
R0010:Itpr3 UTSW 17 27120977 missense probably damaging 1.00
R0055:Itpr3 UTSW 17 27098322 missense probably damaging 1.00
R0068:Itpr3 UTSW 17 27104060 splice site probably benign
R0068:Itpr3 UTSW 17 27104060 splice site probably benign
R0104:Itpr3 UTSW 17 27095992 missense probably benign 0.01
R0195:Itpr3 UTSW 17 27114114 missense probably damaging 1.00
R0212:Itpr3 UTSW 17 27089319 missense probably damaging 1.00
R0454:Itpr3 UTSW 17 27113819 missense probably benign
R0485:Itpr3 UTSW 17 27111929 missense probably damaging 0.98
R0501:Itpr3 UTSW 17 27107289 missense probably benign 0.09
R0781:Itpr3 UTSW 17 27110555 missense probably benign 0.00
R0890:Itpr3 UTSW 17 27089011 nonsense probably null
R1028:Itpr3 UTSW 17 27091369 missense probably benign 0.04
R1144:Itpr3 UTSW 17 27114923 missense probably benign 0.01
R1347:Itpr3 UTSW 17 27111561 missense probably benign 0.02
R1347:Itpr3 UTSW 17 27111561 missense probably benign 0.02
R1458:Itpr3 UTSW 17 27118372 missense probably benign 0.01
R1463:Itpr3 UTSW 17 27117154 splice site probably benign
R1472:Itpr3 UTSW 17 27114225 missense probably benign 0.09
R1529:Itpr3 UTSW 17 27105485 splice site probably null
R1533:Itpr3 UTSW 17 27095560 missense possibly damaging 0.71
R1537:Itpr3 UTSW 17 27114147 missense possibly damaging 0.96
R1618:Itpr3 UTSW 17 27116607 critical splice acceptor site probably null
R1672:Itpr3 UTSW 17 27089013 missense probably benign
R1726:Itpr3 UTSW 17 27111690 missense probably damaging 0.96
R1865:Itpr3 UTSW 17 27120023 missense probably benign 0.01
R1940:Itpr3 UTSW 17 27111217 missense probably damaging 1.00
R2023:Itpr3 UTSW 17 27102811 missense possibly damaging 0.76
R2063:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2064:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2065:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2067:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2068:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2219:Itpr3 UTSW 17 27115053 missense probably benign
R2248:Itpr3 UTSW 17 27115059 missense probably damaging 1.00
R2291:Itpr3 UTSW 17 27113579 missense possibly damaging 0.92
R2320:Itpr3 UTSW 17 27095915 missense probably benign
R2864:Itpr3 UTSW 17 27091551 missense probably benign 0.01
R2865:Itpr3 UTSW 17 27091551 missense probably benign 0.01
R3778:Itpr3 UTSW 17 27095472 missense possibly damaging 0.57
R3881:Itpr3 UTSW 17 27113840 missense probably benign 0.01
R3979:Itpr3 UTSW 17 27085131 missense probably benign 0.23
R3979:Itpr3 UTSW 17 27091572 missense probably damaging 1.00
R4224:Itpr3 UTSW 17 27107258 missense probably damaging 1.00
R4259:Itpr3 UTSW 17 27106324 missense probably damaging 1.00
R4321:Itpr3 UTSW 17 27111974 missense probably benign 0.00
R4466:Itpr3 UTSW 17 27106342 missense probably damaging 1.00
R4493:Itpr3 UTSW 17 27104612 missense probably damaging 1.00
R4597:Itpr3 UTSW 17 27093283 missense probably damaging 1.00
R4823:Itpr3 UTSW 17 27085147 missense probably benign 0.30
R4921:Itpr3 UTSW 17 27098005 missense probably damaging 1.00
R4974:Itpr3 UTSW 17 27083608 missense probably damaging 0.96
R5063:Itpr3 UTSW 17 27089911 missense possibly damaging 0.94
R5079:Itpr3 UTSW 17 27098423 missense probably damaging 1.00
R5303:Itpr3 UTSW 17 27116689 missense probably benign 0.38
R5518:Itpr3 UTSW 17 27087592 missense probably damaging 1.00
R5521:Itpr3 UTSW 17 27107334 missense probably benign 0.09
R5566:Itpr3 UTSW 17 27115952 missense possibly damaging 0.71
R5567:Itpr3 UTSW 17 27103906 missense possibly damaging 0.66
R5579:Itpr3 UTSW 17 27113519 missense probably damaging 1.00
R5610:Itpr3 UTSW 17 27118566 missense probably benign 0.42
R5658:Itpr3 UTSW 17 27107878 missense possibly damaging 0.74
R5856:Itpr3 UTSW 17 27106405 missense probably damaging 1.00
R5872:Itpr3 UTSW 17 27086976 missense probably benign 0.02
R5878:Itpr3 UTSW 17 27110862 missense probably benign 0.01
R5889:Itpr3 UTSW 17 27115065 missense probably damaging 0.99
R5907:Itpr3 UTSW 17 27117893 missense probably damaging 1.00
R5930:Itpr3 UTSW 17 27110921 missense possibly damaging 0.49
R5987:Itpr3 UTSW 17 27104601 missense probably damaging 1.00
R6029:Itpr3 UTSW 17 27098171 missense probably damaging 1.00
R6195:Itpr3 UTSW 17 27086960 missense probably damaging 0.97
R6213:Itpr3 UTSW 17 27111200 missense probably benign 0.03
R6233:Itpr3 UTSW 17 27086960 missense probably damaging 0.97
R6376:Itpr3 UTSW 17 27095475 missense possibly damaging 0.94
R6514:Itpr3 UTSW 17 27091370 missense probably benign
R6515:Itpr3 UTSW 17 27091370 missense probably benign
R6516:Itpr3 UTSW 17 27091370 missense probably benign
R6955:Itpr3 UTSW 17 27121467 missense probably damaging 1.00
R7002:Itpr3 UTSW 17 27110580 missense probably benign 0.00
R7064:Itpr3 UTSW 17 27089295 missense probably damaging 1.00
R7257:Itpr3 UTSW 17 27118561 missense probably benign 0.00
R7349:Itpr3 UTSW 17 27107812 splice site probably null
R7469:Itpr3 UTSW 17 27121054 missense possibly damaging 0.74
R7493:Itpr3 UTSW 17 27094800 missense probably benign 0.09
R7510:Itpr3 UTSW 17 27089039 missense probably damaging 0.97
R7565:Itpr3 UTSW 17 27110888 missense probably benign 0.01
R7616:Itpr3 UTSW 17 27088977 missense probably damaging 1.00
R7728:Itpr3 UTSW 17 27098114 missense probably damaging 1.00
R7779:Itpr3 UTSW 17 27096063 missense probably damaging 1.00
R7788:Itpr3 UTSW 17 27118597 nonsense probably null
R7871:Itpr3 UTSW 17 27117179 missense probably damaging 1.00
R7889:Itpr3 UTSW 17 27116777 missense probably damaging 1.00
R7966:Itpr3 UTSW 17 27112028 critical splice donor site probably null
R8065:Itpr3 UTSW 17 27110862 missense probably benign 0.01
R8067:Itpr3 UTSW 17 27110862 missense probably benign 0.01
R8230:Itpr3 UTSW 17 27107737 critical splice donor site probably null
R8263:Itpr3 UTSW 17 27115913 nonsense probably null
R8264:Itpr3 UTSW 17 27104112 synonymous silent
R8269:Itpr3 UTSW 17 27093284 missense possibly damaging 0.60
R8271:Itpr3 UTSW 17 27087648 missense probably damaging 1.00
R8316:Itpr3 UTSW 17 27106225 missense possibly damaging 0.50
R8354:Itpr3 UTSW 17 27115919 missense possibly damaging 0.74
R8413:Itpr3 UTSW 17 27111926 missense probably damaging 1.00
R8437:Itpr3 UTSW 17 27107303 missense probably damaging 1.00
R8676:Itpr3 UTSW 17 27118677 unclassified probably benign
R8679:Itpr3 UTSW 17 27118677 unclassified probably benign
R8846:Itpr3 UTSW 17 27112022 missense probably damaging 1.00
R8884:Itpr3 UTSW 17 27118677 unclassified probably benign
R8885:Itpr3 UTSW 17 27118677 unclassified probably benign
R8886:Itpr3 UTSW 17 27118677 unclassified probably benign
R8887:Itpr3 UTSW 17 27118677 unclassified probably benign
R8888:Itpr3 UTSW 17 27118677 unclassified probably benign
R8891:Itpr3 UTSW 17 27118677 unclassified probably benign
R8896:Itpr3 UTSW 17 27118677 unclassified probably benign
R8975:Itpr3 UTSW 17 27116654 missense possibly damaging 0.56
R9025:Itpr3 UTSW 17 27118677 unclassified probably benign
R9026:Itpr3 UTSW 17 27118677 unclassified probably benign
R9063:Itpr3 UTSW 17 27118677 unclassified probably benign
R9087:Itpr3 UTSW 17 27118677 unclassified probably benign
R9088:Itpr3 UTSW 17 27118677 unclassified probably benign
R9089:Itpr3 UTSW 17 27118677 unclassified probably benign
R9090:Itpr3 UTSW 17 27118677 unclassified probably benign
R9091:Itpr3 UTSW 17 27118677 unclassified probably benign
R9200:Itpr3 UTSW 17 27107662 missense probably damaging 0.99
R9270:Itpr3 UTSW 17 27118677 unclassified probably benign
R9271:Itpr3 UTSW 17 27118677 unclassified probably benign
R9294:Itpr3 UTSW 17 27111217 missense probably damaging 1.00
R9389:Itpr3 UTSW 17 27095925 missense possibly damaging 0.84
R9433:Itpr3 UTSW 17 27118677 unclassified probably benign
R9434:Itpr3 UTSW 17 27118677 unclassified probably benign
R9443:Itpr3 UTSW 17 27105549 missense probably damaging 1.00
R9472:Itpr3 UTSW 17 27118677 unclassified probably benign
R9474:Itpr3 UTSW 17 27118677 unclassified probably benign
R9475:Itpr3 UTSW 17 27118677 unclassified probably benign
R9476:Itpr3 UTSW 17 27118677 unclassified probably benign
R9507:Itpr3 UTSW 17 27118677 unclassified probably benign
R9508:Itpr3 UTSW 17 27118677 unclassified probably benign
R9511:Itpr3 UTSW 17 27118677 unclassified probably benign
R9694:Itpr3 UTSW 17 27115953 missense probably damaging 0.99
R9789:Itpr3 UTSW 17 27089941 missense probably benign 0.15
V7732:Itpr3 UTSW 17 27111024 splice site probably benign
V7732:Itpr3 UTSW 17 27111026 splice site probably null
Z1088:Itpr3 UTSW 17 27113528 missense possibly damaging 0.50
Z1177:Itpr3 UTSW 17 27114929 missense probably damaging 1.00
Z1177:Itpr3 UTSW 17 27119987 missense probably damaging 1.00
Z31818:Itpr3 UTSW 17 27095478 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTGAGATCCTAGAAGGTGAGACCG -3'
(R):5'- GAAGCCACTGACTGCTGATG -3'

Sequencing Primer
(F):5'- ACCGGCGTCTACAGGATAG -3'
(R):5'- ACTGACTGCTGATGGCCCAC -3'
Posted On 2022-06-15