Incidental Mutation 'R9478:Mab21l3'
ID 715913
Institutional Source Beutler Lab
Gene Symbol Mab21l3
Ensembl Gene ENSMUSG00000044313
Gene Name mab-21-like 3 (C. elegans)
Synonyms BC037703
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock # R9478 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 101813076-101848959 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 101818671 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 336 (D336E)
Ref Sequence ENSEMBL: ENSMUSP00000059212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061831] [ENSMUST00000118411]
AlphaFold Q8CI17
Predicted Effect probably damaging
Transcript: ENSMUST00000061831
AA Change: D336E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000059212
Gene: ENSMUSG00000044313
AA Change: D336E

DomainStartEndE-ValueType
Mab-21 124 422 3.17e-104 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118411
AA Change: D336E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112730
Gene: ENSMUSG00000044313
AA Change: D336E

DomainStartEndE-ValueType
Mab-21 124 422 3.17e-104 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,303,454 I886F possibly damaging Het
3100002H09Rik A G 4: 124,610,358 S134P unknown Het
Abcf2 A G 5: 24,565,942 L604P possibly damaging Het
Arih2 C G 9: 108,611,739 R260P probably damaging Het
Atg14 G T 14: 47,545,681 H373Q probably damaging Het
Atmin C T 8: 116,954,798 H179Y probably damaging Het
Catsperg1 G T 7: 29,198,352 P197T possibly damaging Het
Ccdc189 T C 7: 127,584,915 probably null Het
Ccdc7b C T 8: 129,110,992 Q155* probably null Het
Cep85l T G 10: 53,348,779 E238A possibly damaging Het
Cntln G A 4: 84,979,393 V406I probably benign Het
Csf2rb2 C A 15: 78,284,765 G730V probably benign Het
Cyp3a59 T A 5: 146,098,187 L225Q probably damaging Het
Dock1 T A 7: 134,766,233 F511I probably damaging Het
Dsg1b A T 18: 20,397,951 Y453F Het
Dync1h1 T C 12: 110,658,703 F3829L probably benign Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Esco2 C A 14: 65,831,208 G218* probably null Het
Gale C T 4: 135,965,263 probably benign Het
Grid1 G A 14: 35,321,707 D340N probably damaging Het
Hgf A G 5: 16,561,031 D55G possibly damaging Het
Il17ra A G 6: 120,474,375 D170G possibly damaging Het
Inha A G 1: 75,509,918 S286G probably benign Het
Kdelc2 T C 9: 53,391,936 F232L probably damaging Het
Kif1b C T 4: 149,261,159 probably null Het
Klhl24 T G 16: 20,123,013 S570R possibly damaging Het
Krt83 G A 15: 101,487,568 R308W probably benign Het
Lama2 T A 10: 27,015,482 E2545V probably damaging Het
Lztfl1 T C 9: 123,708,102 K165E possibly damaging Het
Matn2 T C 15: 34,345,096 I83T probably damaging Het
Mfsd9 T C 1: 40,773,781 D458G probably benign Het
Ncbp3 A G 11: 73,077,942 D513G probably damaging Het
Neb T A 2: 52,188,776 K5818N probably benign Het
Nol4 G A 18: 22,920,877 P120S probably damaging Het
Oit3 C A 10: 59,438,642 C112F probably damaging Het
Olfr1270 C A 2: 90,149,251 A252S possibly damaging Het
Olfr472 G A 7: 107,903,031 V105M probably damaging Het
Olfr743 A T 14: 50,533,594 T61S probably benign Het
Olfr782 T A 10: 129,351,091 M176K possibly damaging Het
Pank4 G A 4: 154,980,108 R708Q probably benign Het
Plch1 T A 3: 63,699,404 L1026F probably benign Het
Ptpn3 A T 4: 57,197,573 I772N probably damaging Het
Purb A G 11: 6,475,424 F155L probably damaging Het
Rcor2 C T 19: 7,271,429 R256W probably damaging Het
Rp1 A G 1: 4,347,322 L1189P probably benign Het
Scn1a T C 2: 66,326,149 E472G probably benign Het
Sema3e T C 5: 14,236,372 Y536H probably damaging Het
Serpina3n A T 12: 104,412,413 I331F possibly damaging Het
Sertad3 T C 7: 27,476,254 S38P probably damaging Het
Sfrp4 G T 13: 19,623,440 R3L unknown Het
Slc35a5 T C 16: 45,144,063 E269G probably damaging Het
Snrnp200 G A 2: 127,235,073 probably null Het
Sumo1 A G 1: 59,655,456 probably null Het
Syne2 A G 12: 76,107,613 K2020E probably damaging Het
Tcp10a A T 17: 7,334,341 T247S probably benign Het
Tgds T C 14: 118,115,132 D290G possibly damaging Het
Trav7d-3 A T 14: 52,744,597 I32F possibly damaging Het
Vps41 A G 13: 18,862,743 N788D Het
Zfp521 G A 18: 13,817,315 T1194I probably damaging Het
Zmynd8 C A 2: 165,807,649 K841N probably damaging Het
Other mutations in Mab21l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Mab21l3 APN 3 101823455 missense probably damaging 0.99
IGL01123:Mab21l3 APN 3 101835130 missense probably benign 0.06
IGL01997:Mab21l3 APN 3 101818639 missense probably damaging 0.99
IGL02423:Mab21l3 APN 3 101818729 missense probably damaging 1.00
IGL02546:Mab21l3 APN 3 101823308 missense probably damaging 1.00
R1268:Mab21l3 UTSW 3 101835047 missense possibly damaging 0.88
R1803:Mab21l3 UTSW 3 101835130 missense probably benign 0.06
R2056:Mab21l3 UTSW 3 101815153 missense possibly damaging 0.55
R2104:Mab21l3 UTSW 3 101823428 missense probably benign 0.31
R3107:Mab21l3 UTSW 3 101826796 missense probably damaging 1.00
R3405:Mab21l3 UTSW 3 101823531 missense probably damaging 1.00
R3406:Mab21l3 UTSW 3 101823531 missense probably damaging 1.00
R5715:Mab21l3 UTSW 3 101823407 missense probably benign 0.36
R6612:Mab21l3 UTSW 3 101818645 missense possibly damaging 0.55
R7183:Mab21l3 UTSW 3 101815153 missense probably damaging 1.00
R8933:Mab21l3 UTSW 3 101823458 missense probably benign
R9187:Mab21l3 UTSW 3 101823278 missense probably benign 0.00
R9342:Mab21l3 UTSW 3 101835203 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACAGCTGGGGTTTATGTCTCC -3'
(R):5'- CACAGTATCCAGCTTCGTGC -3'

Sequencing Primer
(F):5'- TATGTCTCCAGGAGCTGAGC -3'
(R):5'- GTGCTTCTCATCTTTCCAATCCTG -3'
Posted On 2022-06-15