Incidental Mutation 'R9478:Cntln'
ID 715915
Institutional Source Beutler Lab
Gene Symbol Cntln
Ensembl Gene ENSMUSG00000038070
Gene Name centlein, centrosomal protein
Synonyms B430108F07Rik, D530005L17Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock # R9478 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 84884309-85131921 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 84979393 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 406 (V406I)
Ref Sequence ENSEMBL: ENSMUSP00000044138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047023] [ENSMUST00000169371]
AlphaFold A2AM05
Predicted Effect probably benign
Transcript: ENSMUST00000047023
AA Change: V406I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000044138
Gene: ENSMUSG00000038070
AA Change: V406I

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.25e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.25e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 973 1114 N/A INTRINSIC
low complexity region 1206 1217 N/A INTRINSIC
Blast:HisKA 1270 1326 1e-24 BLAST
low complexity region 1327 1348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169371
AA Change: V406I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000130491
Gene: ENSMUSG00000038070
AA Change: V406I

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.24e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.24e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 972 1113 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
Blast:HisKA 1269 1325 1e-24 BLAST
low complexity region 1326 1347 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,303,454 I886F possibly damaging Het
3100002H09Rik A G 4: 124,610,358 S134P unknown Het
Abcf2 A G 5: 24,565,942 L604P possibly damaging Het
Arih2 C G 9: 108,611,739 R260P probably damaging Het
Atg14 G T 14: 47,545,681 H373Q probably damaging Het
Atmin C T 8: 116,954,798 H179Y probably damaging Het
Catsperg1 G T 7: 29,198,352 P197T possibly damaging Het
Ccdc189 T C 7: 127,584,915 probably null Het
Ccdc7b C T 8: 129,110,992 Q155* probably null Het
Cep85l T G 10: 53,348,779 E238A possibly damaging Het
Csf2rb2 C A 15: 78,284,765 G730V probably benign Het
Cyp3a59 T A 5: 146,098,187 L225Q probably damaging Het
Dock1 T A 7: 134,766,233 F511I probably damaging Het
Dsg1b A T 18: 20,397,951 Y453F Het
Dync1h1 T C 12: 110,658,703 F3829L probably benign Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Esco2 C A 14: 65,831,208 G218* probably null Het
Gale C T 4: 135,965,263 probably benign Het
Grid1 G A 14: 35,321,707 D340N probably damaging Het
Hgf A G 5: 16,561,031 D55G possibly damaging Het
Il17ra A G 6: 120,474,375 D170G possibly damaging Het
Inha A G 1: 75,509,918 S286G probably benign Het
Kdelc2 T C 9: 53,391,936 F232L probably damaging Het
Kif1b C T 4: 149,261,159 probably null Het
Klhl24 T G 16: 20,123,013 S570R possibly damaging Het
Krt83 G A 15: 101,487,568 R308W probably benign Het
Lama2 T A 10: 27,015,482 E2545V probably damaging Het
Lztfl1 T C 9: 123,708,102 K165E possibly damaging Het
Mab21l3 A T 3: 101,818,671 D336E probably damaging Het
Matn2 T C 15: 34,345,096 I83T probably damaging Het
Mfsd9 T C 1: 40,773,781 D458G probably benign Het
Ncbp3 A G 11: 73,077,942 D513G probably damaging Het
Neb T A 2: 52,188,776 K5818N probably benign Het
Nol4 G A 18: 22,920,877 P120S probably damaging Het
Oit3 C A 10: 59,438,642 C112F probably damaging Het
Olfr1270 C A 2: 90,149,251 A252S possibly damaging Het
Olfr472 G A 7: 107,903,031 V105M probably damaging Het
Olfr743 A T 14: 50,533,594 T61S probably benign Het
Olfr782 T A 10: 129,351,091 M176K possibly damaging Het
Pank4 G A 4: 154,980,108 R708Q probably benign Het
Plch1 T A 3: 63,699,404 L1026F probably benign Het
Ptpn3 A T 4: 57,197,573 I772N probably damaging Het
Purb A G 11: 6,475,424 F155L probably damaging Het
Rcor2 C T 19: 7,271,429 R256W probably damaging Het
Rp1 A G 1: 4,347,322 L1189P probably benign Het
Scn1a T C 2: 66,326,149 E472G probably benign Het
Sema3e T C 5: 14,236,372 Y536H probably damaging Het
Serpina3n A T 12: 104,412,413 I331F possibly damaging Het
Sertad3 T C 7: 27,476,254 S38P probably damaging Het
Sfrp4 G T 13: 19,623,440 R3L unknown Het
Slc35a5 T C 16: 45,144,063 E269G probably damaging Het
Snrnp200 G A 2: 127,235,073 probably null Het
Sumo1 A G 1: 59,655,456 probably null Het
Syne2 A G 12: 76,107,613 K2020E probably damaging Het
Tcp10a A T 17: 7,334,341 T247S probably benign Het
Tgds T C 14: 118,115,132 D290G possibly damaging Het
Trav7d-3 A T 14: 52,744,597 I32F possibly damaging Het
Vps41 A G 13: 18,862,743 N788D Het
Zfp521 G A 18: 13,817,315 T1194I probably damaging Het
Zmynd8 C A 2: 165,807,649 K841N probably damaging Het
Other mutations in Cntln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Cntln APN 4 85006434 missense probably benign 0.25
IGL00743:Cntln APN 4 84979415 missense probably benign 0.06
IGL01014:Cntln APN 4 85049908 missense probably benign 0.25
IGL02217:Cntln APN 4 85100258 missense probably damaging 1.00
IGL02323:Cntln APN 4 85049789 missense probably benign 0.00
IGL02353:Cntln APN 4 85049850 missense probably damaging 0.98
IGL02360:Cntln APN 4 85049850 missense probably damaging 0.98
IGL02616:Cntln APN 4 85115452 critical splice donor site probably null
PIT4696001:Cntln UTSW 4 84974000 missense probably damaging 0.99
R0110:Cntln UTSW 4 85096757 missense probably damaging 1.00
R0324:Cntln UTSW 4 85092695 missense probably damaging 0.98
R0349:Cntln UTSW 4 84996485 missense probably damaging 1.00
R0519:Cntln UTSW 4 85005053 splice site probably benign
R0529:Cntln UTSW 4 85067825 missense probably damaging 1.00
R0582:Cntln UTSW 4 84884741 missense probably damaging 1.00
R1077:Cntln UTSW 4 84996479 missense probably damaging 1.00
R1345:Cntln UTSW 4 84973991 missense probably damaging 1.00
R1457:Cntln UTSW 4 85096839 missense probably benign 0.33
R1571:Cntln UTSW 4 84947586 nonsense probably null
R1622:Cntln UTSW 4 85063181 missense probably damaging 1.00
R1681:Cntln UTSW 4 84947635 missense probably damaging 1.00
R1777:Cntln UTSW 4 85130679 missense probably benign 0.23
R1808:Cntln UTSW 4 85096763 missense probably damaging 1.00
R1882:Cntln UTSW 4 85100835 missense probably damaging 1.00
R2056:Cntln UTSW 4 85049674 missense probably benign
R2965:Cntln UTSW 4 84974027 critical splice donor site probably null
R2968:Cntln UTSW 4 84957267 missense probably benign 0.27
R3104:Cntln UTSW 4 84957169 missense possibly damaging 0.95
R3106:Cntln UTSW 4 84957169 missense possibly damaging 0.95
R3121:Cntln UTSW 4 85005052 splice site probably benign
R3617:Cntln UTSW 4 85004977 nonsense probably null
R4009:Cntln UTSW 4 85063215 missense probably benign 0.45
R4036:Cntln UTSW 4 85006488 missense probably damaging 1.00
R4548:Cntln UTSW 4 85096842 missense probably benign 0.27
R4592:Cntln UTSW 4 84971182 missense probably benign 0.00
R4666:Cntln UTSW 4 84971216 missense probably benign 0.13
R4826:Cntln UTSW 4 85005044 missense probably benign 0.03
R4836:Cntln UTSW 4 85049720 nonsense probably null
R4856:Cntln UTSW 4 84971229 missense probably benign 0.35
R4886:Cntln UTSW 4 84971229 missense probably benign 0.35
R4995:Cntln UTSW 4 85049883 missense probably benign 0.00
R5090:Cntln UTSW 4 84947593 missense probably damaging 0.98
R5202:Cntln UTSW 4 84971229 missense probably benign 0.35
R5905:Cntln UTSW 4 84971173 missense probably benign 0.03
R5953:Cntln UTSW 4 85049919 missense possibly damaging 0.92
R6028:Cntln UTSW 4 84971173 missense probably benign 0.03
R6298:Cntln UTSW 4 85096761 missense probably damaging 1.00
R6351:Cntln UTSW 4 85115354 missense probably damaging 0.99
R6371:Cntln UTSW 4 84884579 missense probably damaging 0.98
R6481:Cntln UTSW 4 85067510 missense probably benign 0.00
R6864:Cntln UTSW 4 85096792 missense probably damaging 0.99
R6874:Cntln UTSW 4 85067759 missense probably damaging 1.00
R6919:Cntln UTSW 4 85115368 missense probably benign 0.04
R7071:Cntln UTSW 4 85100385 missense probably damaging 1.00
R7113:Cntln UTSW 4 85049827 missense probably damaging 0.98
R7152:Cntln UTSW 4 84884700 missense possibly damaging 0.87
R7253:Cntln UTSW 4 85118473 missense probably damaging 1.00
R7289:Cntln UTSW 4 85046303 missense possibly damaging 0.80
R7440:Cntln UTSW 4 85063216 missense possibly damaging 0.95
R7670:Cntln UTSW 4 84979340 missense possibly damaging 0.66
R7707:Cntln UTSW 4 84884616 missense probably damaging 1.00
R7895:Cntln UTSW 4 85063324 missense possibly damaging 0.91
R8176:Cntln UTSW 4 84888689 missense probably damaging 0.99
R8247:Cntln UTSW 4 85100780 missense probably benign 0.39
R8264:Cntln UTSW 4 85098411 missense probably damaging 1.00
R8293:Cntln UTSW 4 85033838 missense probably damaging 1.00
R8536:Cntln UTSW 4 84957049 missense probably damaging 1.00
R8844:Cntln UTSW 4 84973997 missense probably damaging 1.00
R8924:Cntln UTSW 4 84888699 missense probably damaging 1.00
R8955:Cntln UTSW 4 85067873 missense possibly damaging 0.85
R8960:Cntln UTSW 4 85100724 missense possibly damaging 0.59
R8979:Cntln UTSW 4 85130673 missense probably damaging 1.00
R9255:Cntln UTSW 4 85100866 missense possibly damaging 0.93
R9314:Cntln UTSW 4 85006482 missense probably damaging 1.00
R9353:Cntln UTSW 4 84884360 unclassified probably benign
R9361:Cntln UTSW 4 85049914 missense probably benign 0.23
R9376:Cntln UTSW 4 84957021 missense probably benign 0.24
R9382:Cntln UTSW 4 85050081 missense probably benign 0.13
R9471:Cntln UTSW 4 85049782 missense possibly damaging 0.62
R9527:Cntln UTSW 4 84973883 missense probably damaging 1.00
R9788:Cntln UTSW 4 85049856 missense probably damaging 1.00
R9793:Cntln UTSW 4 85067561 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCAATAACACGTTGTACATTTTG -3'
(R):5'- CTAATATCTTCTGTAGTTCTACATGCG -3'

Sequencing Primer
(F):5'- ATCACTTGTACATTGTGTCTAGTTG -3'
(R):5'- CTGTAGTTCTACATGCGTTTCC -3'
Posted On 2022-06-15