Incidental Mutation 'R9478:Epha8'
ID 715918
Institutional Source Beutler Lab
Gene Symbol Epha8
Ensembl Gene ENSMUSG00000028661
Gene Name Eph receptor A8
Synonyms EphA8, Hek3, Eek
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9478 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 136929419-136956816 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 136938586 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Methionine at position 420 (L420M)
Ref Sequence ENSEMBL: ENSMUSP00000030420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030420]
AlphaFold O09127
Predicted Effect probably damaging
Transcript: ENSMUST00000030420
AA Change: L420M

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030420
Gene: ENSMUSG00000028661
AA Change: L420M

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
EPH_lbd 30 203 2.59e-116 SMART
FN3 328 418 4.03e-6 SMART
FN3 439 520 1.67e-12 SMART
Pfam:EphA2_TM 542 631 5.8e-10 PFAM
TyrKc 634 891 1.03e-125 SMART
SAM 926 993 4.74e-19 SMART
Meta Mutation Damage Score 0.1158 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. The protein encoded by this gene functions as a receptor for ephrin A2, A3 and A5 and plays a role in short-range contact-mediated axonal guidance during development of the mammalian nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for this targeted mutation are viable, fertile, and grossly normal but exhibit a commissural defect, whereby tectal axons fail to project from the superior colliculus of the midbrain to the contralateral inferior colliculus and instead project to the ipsilateral cervical spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,303,454 I886F possibly damaging Het
3100002H09Rik A G 4: 124,610,358 S134P unknown Het
Abcf2 A G 5: 24,565,942 L604P possibly damaging Het
Arih2 C G 9: 108,611,739 R260P probably damaging Het
Atg14 G T 14: 47,545,681 H373Q probably damaging Het
Atmin C T 8: 116,954,798 H179Y probably damaging Het
Catsperg1 G T 7: 29,198,352 P197T possibly damaging Het
Ccdc189 T C 7: 127,584,915 probably null Het
Ccdc7b C T 8: 129,110,992 Q155* probably null Het
Cep85l T G 10: 53,348,779 E238A possibly damaging Het
Cntln G A 4: 84,979,393 V406I probably benign Het
Csf2rb2 C A 15: 78,284,765 G730V probably benign Het
Cyp3a59 T A 5: 146,098,187 L225Q probably damaging Het
Dock1 T A 7: 134,766,233 F511I probably damaging Het
Dsg1b A T 18: 20,397,951 Y453F Het
Dync1h1 T C 12: 110,658,703 F3829L probably benign Het
Esco2 C A 14: 65,831,208 G218* probably null Het
Gale C T 4: 135,965,263 probably benign Het
Grid1 G A 14: 35,321,707 D340N probably damaging Het
Hgf A G 5: 16,561,031 D55G possibly damaging Het
Il17ra A G 6: 120,474,375 D170G possibly damaging Het
Inha A G 1: 75,509,918 S286G probably benign Het
Kdelc2 T C 9: 53,391,936 F232L probably damaging Het
Kif1b C T 4: 149,261,159 probably null Het
Klhl24 T G 16: 20,123,013 S570R possibly damaging Het
Krt83 G A 15: 101,487,568 R308W probably benign Het
Lama2 T A 10: 27,015,482 E2545V probably damaging Het
Lztfl1 T C 9: 123,708,102 K165E possibly damaging Het
Mab21l3 A T 3: 101,818,671 D336E probably damaging Het
Matn2 T C 15: 34,345,096 I83T probably damaging Het
Mfsd9 T C 1: 40,773,781 D458G probably benign Het
Ncbp3 A G 11: 73,077,942 D513G probably damaging Het
Neb T A 2: 52,188,776 K5818N probably benign Het
Nol4 G A 18: 22,920,877 P120S probably damaging Het
Oit3 C A 10: 59,438,642 C112F probably damaging Het
Olfr1270 C A 2: 90,149,251 A252S possibly damaging Het
Olfr472 G A 7: 107,903,031 V105M probably damaging Het
Olfr743 A T 14: 50,533,594 T61S probably benign Het
Olfr782 T A 10: 129,351,091 M176K possibly damaging Het
Pank4 G A 4: 154,980,108 R708Q probably benign Het
Plch1 T A 3: 63,699,404 L1026F probably benign Het
Ptpn3 A T 4: 57,197,573 I772N probably damaging Het
Purb A G 11: 6,475,424 F155L probably damaging Het
Rcor2 C T 19: 7,271,429 R256W probably damaging Het
Rp1 A G 1: 4,347,322 L1189P probably benign Het
Scn1a T C 2: 66,326,149 E472G probably benign Het
Sema3e T C 5: 14,236,372 Y536H probably damaging Het
Serpina3n A T 12: 104,412,413 I331F possibly damaging Het
Sertad3 T C 7: 27,476,254 S38P probably damaging Het
Sfrp4 G T 13: 19,623,440 R3L unknown Het
Slc35a5 T C 16: 45,144,063 E269G probably damaging Het
Snrnp200 G A 2: 127,235,073 probably null Het
Sumo1 A G 1: 59,655,456 probably null Het
Syne2 A G 12: 76,107,613 K2020E probably damaging Het
Tcp10a A T 17: 7,334,341 T247S probably benign Het
Tgds T C 14: 118,115,132 D290G possibly damaging Het
Trav7d-3 A T 14: 52,744,597 I32F possibly damaging Het
Vps41 A G 13: 18,862,743 N788D Het
Zfp521 G A 18: 13,817,315 T1194I probably damaging Het
Zmynd8 C A 2: 165,807,649 K841N probably damaging Het
Other mutations in Epha8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Epha8 APN 4 136945810 missense probably damaging 1.00
IGL00960:Epha8 APN 4 136951839 splice site probably null
IGL01124:Epha8 APN 4 136936083 missense probably damaging 1.00
IGL01550:Epha8 APN 4 136931740 missense possibly damaging 0.87
IGL01807:Epha8 APN 4 136931682 missense probably benign 0.08
IGL01844:Epha8 APN 4 136931049 makesense probably null
IGL02167:Epha8 APN 4 136931094 missense probably damaging 1.00
R0255:Epha8 UTSW 4 136940286 missense probably damaging 0.99
R0445:Epha8 UTSW 4 136932400 missense probably damaging 1.00
R1757:Epha8 UTSW 4 136931478 splice site probably null
R1911:Epha8 UTSW 4 136936314 missense probably damaging 1.00
R1936:Epha8 UTSW 4 136940243 missense probably benign 0.08
R2291:Epha8 UTSW 4 136933347 missense probably damaging 1.00
R2359:Epha8 UTSW 4 136946032 missense probably damaging 1.00
R2372:Epha8 UTSW 4 136933010 missense probably damaging 1.00
R4581:Epha8 UTSW 4 136933464 missense probably damaging 1.00
R4747:Epha8 UTSW 4 136938695 frame shift probably null
R4784:Epha8 UTSW 4 136933322 missense probably damaging 1.00
R5156:Epha8 UTSW 4 136938726 missense probably benign 0.14
R5164:Epha8 UTSW 4 136945672 missense possibly damaging 0.93
R5335:Epha8 UTSW 4 136931935 missense probably damaging 1.00
R5480:Epha8 UTSW 4 136935130 missense probably benign
R5552:Epha8 UTSW 4 136931899 missense probably damaging 1.00
R5830:Epha8 UTSW 4 136936390 nonsense probably null
R6017:Epha8 UTSW 4 136931743 missense probably damaging 1.00
R6450:Epha8 UTSW 4 136931899 missense probably damaging 1.00
R6798:Epha8 UTSW 4 136945669 missense probably benign 0.00
R6799:Epha8 UTSW 4 136945669 missense probably benign 0.00
R7060:Epha8 UTSW 4 136931158 missense probably damaging 1.00
R7297:Epha8 UTSW 4 136945913 missense probably damaging 1.00
R7344:Epha8 UTSW 4 136934538 missense probably benign 0.14
R7467:Epha8 UTSW 4 136931088 missense possibly damaging 0.90
R7563:Epha8 UTSW 4 136938789 missense possibly damaging 0.77
R7826:Epha8 UTSW 4 136936187 missense probably benign 0.09
R7845:Epha8 UTSW 4 136936401 missense probably benign 0.04
R7863:Epha8 UTSW 4 136933655 missense probably damaging 1.00
R7904:Epha8 UTSW 4 136931739 missense possibly damaging 0.95
R7918:Epha8 UTSW 4 136934566 missense probably benign 0.12
R8177:Epha8 UTSW 4 136945663 missense probably benign 0.00
R8244:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8266:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8268:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8269:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8289:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8290:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8294:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8295:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8299:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8445:Epha8 UTSW 4 136932289 missense probably benign 0.13
R8889:Epha8 UTSW 4 136934539 missense probably benign 0.45
R8892:Epha8 UTSW 4 136934539 missense probably benign 0.45
R8928:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8965:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8983:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8984:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8988:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R9081:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R9231:Epha8 UTSW 4 136945915 missense probably damaging 1.00
R9262:Epha8 UTSW 4 136931684 missense probably benign
R9370:Epha8 UTSW 4 136946200 missense possibly damaging 0.94
R9466:Epha8 UTSW 4 136935103 missense probably benign
R9546:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R9547:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R9550:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R9585:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R9624:Epha8 UTSW 4 136931754 missense probably damaging 1.00
R9686:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R9687:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R9690:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R9744:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R9763:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R9794:Epha8 UTSW 4 136938724 missense probably benign 0.16
RF025:Epha8 UTSW 4 136933037 critical splice acceptor site probably benign
RF054:Epha8 UTSW 4 136933037 critical splice acceptor site probably benign
Z1176:Epha8 UTSW 4 136938696 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTGATGACTGCCTCTGTGTTC -3'
(R):5'- ATCACCTACAACGCAGTGTGC -3'

Sequencing Primer
(F):5'- CAGACTGAGTTCTGCTTTCCTATAGG -3'
(R):5'- AGTGGAACTCGCTTCGT -3'
Posted On 2022-06-15